Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU157781

Sigma-Aldrich

MISSION® esiRNA

targeting human FLNA

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GACATCATCCGCAATGACAATGACACCTTCACGGTCAAGTACACGCCCCGGGGGGCTGGCAGCTACACCATTATGGTCCTCTTTGCTGACCAGGCCACGCCCACCAGCCCCATCCGAGTCAAGGTGGAGCCCTCTCATGACGCCAGTAAGGTGAAGGCCGAGGGCCCTGGCCTCAGTCGCACTGGTGTCGAGCTTGGCAAGCCCACCCACTTCACAGTAAATGCCAAAGCTGCTGGCAAAGGCAAGCTGGACGTCCAGTTCTCAGGACTCACCAAGGGGGATGCAGTGCGAGATGTGGACATCATCGACCACCATGACAACACCTACACAGTCAAGTACACGCCTGTCCAGCAGGGTCCAGTAGGCGTCAATGTCACTTATGGAGGGGATCCCATCCCTAAGAGCCCTTTC

Ensembl | human accession no.

ENSG00000196924

NCBI accession no.

NM_001456

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... FLNA(2316) , FLNA(2316)

Categorías relacionadas

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Qian Wang et al.
PloS one, 10(4), e0123018-e0123018 (2015-04-11)
Polycystin-2 (PC2), encoded by the PKD2 gene, is mutated in ~15% of autosomal dominant polycystic kidney disease. Filamins are actin-binding proteins implicated in scaffolding and membrane stabilization. Here we studied the effects of filamin on PC2 stability using filamin-deficient human
Alessandra Mingione et al.
Journal of molecular endocrinology, 58(2), 91-103 (2016-11-23)
Parathyroid tumors display reduced sensitivity to extracellular calcium ([Ca
E Peverelli et al.
Endocrinology, 155(8), 2932-2941 (2014-05-16)
Somatostatin receptor type 2 (SST2) is the main pharmacological target of medical therapy for GH-secreting pituitary tumors, but molecular mechanisms regulating its expression and signaling are largely unknown. The aim of this study was to investigate the role of cytoskeleton
R Catalano et al.
Cancer letters, 497, 77-88 (2020-10-20)
Adrenocortical carcinomas (ACCs) overexpress insulin-like growth factor 2 (IGF2), that drives a proliferative autocrine loop by binding to IGF1R and IR, but IGF1R/IR-targeted therapies failed in ACC patients. The cytoskeleton actin-binding protein filamin A (FLNA) impairs IR signalling in melanoma
Rosalinda M Savoy et al.
Endocrine-related cancer, 22(3), 369-386 (2015-03-12)
Prostate cancer (PCa) progression is regulated by the androgen receptor (AR); however, patients undergoing androgen-deprivation therapy (ADT) for disseminated PCa eventually develop castration-resistant PCa (CRPC). Results of previous studies indicated that AR, a transcription factor, occupies distinct genomic loci in
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico