Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EHU149771

Sigma-Aldrich

MISSION® esiRNA

targeting human T

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCGTCTCCTTCAGCAAAGTCAAGCTCACCAACAAGCTCAACGGAGGGGGCCAGATCATGCTGAACTCCTTGCATAAGTATGAGCCTCGAATCCACATAGTGAGAGTTGGGGGTCCACAGCGCATGATCACCAGCCACTGCTTCCCTGAGACCCAGTTCATAGCGGTGACTGCTTATCAGAACGAGGAGATCACAGCTCTTAAAATTAAGTACAATCCATTTGCAAAAGCTTTCCTTGATGCAAAGGAAAGAAGTGATCACAAAGAGATGATGGAGGAACCCGGAGACAGCCAGCAACCTGGGTACTCCCAATGGGGGTGGCTTCTTCCTGGAACCAGCACCCTGTGTCCACCTGCAAATCCTCATCCTCAGTTTGGAGGTGCCCTCTCCCTCCCCTCCACGCACAGCTGTGACAGGTACCCAACCCTGAGGAGCCACCGGTCCTCACCCTACCCCAGCCCCTATGCTCATCGGAACAATTCTCCAACCTATTCTGACAACTCACCTGCATGTTTATCCATGCTGCAATCCCATGACAATTG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... T(6862) , T(6862)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Zewen Kelvin Tuong et al.
PloS one, 11(1), e0147179-e0147179 (2016-01-27)
Nuclear hormone receptors have important roles in the regulation of metabolic and inflammatory pathways. The retinoid-related orphan receptor alpha (Rorα)-deficient staggerer (sg/sg) mice display several phenotypes indicative of aberrant lipid metabolism, including dyslipidemia, and increased susceptibility to atherosclerosis. In this
Y J Yang et al.
Cell death & disease, 6, e2025-e2025 (2015-12-18)
Taurine, which is found at high concentration in the heart, exerts several protective actions on myocardium. Physically, the high level of taurine in heart is maintained by a taurine transporter (TauT), the expression of which is suppressed under ischemic insult.
Yi-Hui Yu et al.
International journal of clinical and experimental pathology, 8(3), 2582-2589 (2015-06-06)
The aim of this study was to determine whether long non-coding RNA PVT1 can participate in the regulation of cardiac hypertrophy. A C57BL/6 mouse cardiac hypertrophic model was established using transverse aortic constriction (TAC). The animals subjected to sham operation
Alexander Michael Tabony et al.
Skeletal muscle, 4, 20-20 (2015-01-28)
Circulating angiotensin II (AngII) is elevated in congestive heart failure (CHF), and leads to skeletal muscle wasting, which is strongly associated with poor patient outcomes. We previously found that AngII upregulates protein phosphatase 2C-alpha (PP2Cα) and dephosphorylates AMP-activated protein kinase
Jiaxuan Chen et al.
Journal of tissue engineering and regenerative medicine, 10(1), 40-51 (2013-06-21)
1α,25-Dihydroxyvitamin D3 [1α,25(OH)2D3] and bone morphogenetic protein-2 (BMP2) are both used to stimulate osteoblastic differentiation. 1α,25(OH)2D3 regulates osteoblasts through classical steroid hormone receptor mechanisms and through rapid responses that are mediated by two receptors, the traditional vitamin D receptor (VDR)

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico