Skip to Content
Merck
All Photos(1)

Key Documents

EHU058791

Sigma-Aldrich

MISSION® esiRNA

targeting human PPARD

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AAGGCCTTCTCCAAGCACATCTACAATGCCTACCTGAAAAACTTCAACATGACCAAAAAGAAGGCCCGCAGCATCCTCACCGGCAAAGCCAGCCACACGGCGCCCTTTGTGATCCACGACATCGAGACATTGTGGCAGGCAGAGAAGGGGCTGGTGTGGAAGCAGTTGGTGAATGGCCTGCCTCCCTACAAGGAGATCAGCGTGCACGTCTTCTACCGCTGCCAGTGCACCACAGTGGAGACCGTGCGGGAGCTCACTGAGTTCGCCAAGAGCATCCCCAGCTTCAGCAGCCTCTTCCTCAACGACCAGGTTACCCTTCTCAAGTATGGCGTGCACGAGGCCATCTTCGCCATGCTGGCCTCTATCGTCAACAAGGACGGGCTGCTGGTAGCCAACGGCAGTGGCTTTGTCACCCGTGAGTTCCTGCGCAGCCTCCGCAAACCCTTCAGTGATATCATTGAGCCTAAGTTTGAATTTGCTGTCAAGTTCAACGC

Ensembl | human accession no.

ENSG00000112033

NCBI accession no.

NM_006238

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... PPARD(5467) , PPARD(5467)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Mark Wei Yi Tan et al.
Cell death and differentiation, 27(9), 2668-2680 (2020-04-22)
The incidence of nonmelanoma skin cancer (NMSC) has been increasing worldwide. Most studies have highlighted the importance of cancer-associated fibroblasts (CAFs) in NMSC progression. However much less is known about the communication between normal fibroblasts and epithelia; disruption of this
Yi Liu et al.
Cancer research, 79(5), 954-969 (2019-01-27)
APC mutations activate aberrant β-catenin signaling to drive initiation of colorectal cancer; however, colorectal cancer progression requires additional molecular mechanisms. PPAR-delta (PPARD), a downstream target of β-catenin, is upregulated in colorectal cancer. However, promotion of intestinal tumorigenesis following deletion of
H B Shi et al.
Journal of dairy science, 100(1), 797-806 (2016-11-21)
In rodents, peroxisome proliferator-activated receptor delta (PPARD) is associated primarily with catabolism of fatty acids. However, the role of PPARD in regulating lipid metabolism in ruminant mammary gland remains unknown. In the present study, we assessed the mRNA abundance of
Trang Thi Thu Nguyen et al.
The Journal of clinical investigation, 130(7), 3699-3716 (2020-04-22)
The Warburg effect is a tumor-related phenomenon that could potentially be targeted therapeutically. Here, we showed that glioblastoma (GBM) cultures and patients' tumors harbored super-enhancers in several genes related to the Warburg effect. By conducting a transcriptome analysis followed by

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service