Skip to Content
Merck
All Photos(1)

Key Documents

EHU030221

Sigma-Aldrich

MISSION® esiRNA

targeting human SATB2

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CAACCAAGTGCCAGGAGTTTGGGAGATGGTATAAAAAGTACAAGAAGATTAAAGTGGAAAGAGTGGAACGAGAAAACCTTTCAGACTATTGTGTTCTGGGCCAGCGTCCAATGCATTTACCAAATATGAACCAGCTGGCATCCCTGGGGAAAACCAACGAACAGTCTCCTCACAGCCAAATTCACCACAGTACTCCAATCCGAAACCAAGTGCCCGCATTACAGCCCATCATGAGCCCTGGTCTTCTTTCTCCCCAGCTTAGTCCACAACTTGTAAGGCAACAAATAGCCATGGCCCATCTGATAAACCAACAGATTGCCGTTAGCCGGCTCCTGGCTCACCAGCATCCTCAAGCCATCAACCAGCAGTTCCTGAACCATCCACCCATCCCCAGAGCAGTTAAGCCAGAGCCAAC

Ensembl | human accession no.

ENSG00000119042

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... SATB2(23314) , SATB2(23314)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

J-Y Li et al.
European review for medical and pharmacological sciences, 23(15), 6394-6403 (2019-08-06)
We aimed to explore the role of microRNA-449b-5p in osteogenic differentiation of bone marrow mesenchymal stem cells (BMSCs) and its mechanism of action. Quantitative Real Time-Polymerase Chain Reaction (qRT-PCR) assay was used to detect the expression levels of microRNA-449b-5p and
Yi-Qing Wang et al.
Cancer research, 79(14), 3542-3556 (2019-03-13)
Accumulating evidence suggests that long noncoding RNA (lncRNA) plays important regulatory roles in cancer biology. However, the involvement of lncRNA in colorectal carcinoma progression remains largely unknown, especially in colorectal carcinoma metastasis. In this study, we investigated the changes in
Jianbing Hao et al.
Cell and tissue research, 366(3), 733-746 (2016-08-10)
Increasing evidence shows that aldosterone and specific microRNAs (miRs) contribute to vascular smooth muscle cell (VSMC) calcification. In this study, we aim to explore the mechanistic links between miR-34b/c and aldosterone in VSMC calcification. VSMC calcification models were established both
Jianfei Tang et al.
Bone, 114, 137-143 (2018-06-18)
Emerging evidence indicates that microRNAs (miRNAs, miRs) play diverse roles in the regulation of biological processes, including osteoblastic differentiation. In this study, we found that miR-383 is a critical regulator of osteoblastic differentiation. We showed that miR-383 was downregulated during

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service