Skip to Content
Merck
All Photos(1)

Key Documents

EHU113911

Sigma-Aldrich

MISSION® esiRNA

targeting human XRCC6

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AACATGTCAGGGTGGGAGTCATATTACAAAACCGAGGGCGATGAAGAAGCAGAGGAAGAACAAGAAGAGAACCTTGAAGCAAGTGGAGACTATAAATATTCAGGAAGAGATAGTTTGATTTTTTTGGTTGATGCCTCCAAGGCTATGTTTGAATCTCAGAGTGAAGATGAGTTGACACCTTTTGACATGAGCATCCAGTGTATCCAAAGTGTGTACATCAGTAAGATCATAAGCAGTGATCGAGATCTCTTGGCTGTGGTGTTCTATGGTACCGAGAAAGACAAAAATTCAGTGAATTTTAAAAATATTTACGTCTTACAGGAGCTGGATAATCCAGGTGCAAAACGAATTCTAGAGCTTGACCAGTTTAAGGGGCAGCAGGGACAAAAACGTTTCCAAGACATGATGGGC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

Related Categories

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Ke Luo et al.
OncoTargets and therapy, 11, 7559-7567 (2018-11-23)
As one of the most prevalent malignancies, glioma is characterized by poor prognosis and high mortality rate. Glioma patients may show completely distinct clinical outcomes due to their different molecular patterns. Sirtuin 3 (Sirt3) participates in aging, stress resistance, and
Jiali Ma et al.
Biochemical and biophysical research communications, 484(4), 746-752 (2017-02-06)
The current study focused on the role of Ku70, a DNA-dependent protein kinase (DNA-PK) complex protein, in pancreatic cancer cell resistance to gemcitabine. In both established cell lines (Mia-PaCa-2 and PANC-1) and primary human pancreatic cancer cells, shRNA/siRNA-mediated knockdown of
Manila Hada et al.
Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine, 37(10), 13903-13914 (2016-08-05)
The first known function of Ku70 is as a DNA repair factor in the nucleus. Using neuronal neuroblastoma cells as a model, we have established that cytosolic Ku70 binds to the pro-apoptotic protein Bax in the cytosol and blocks Bax's
Raghavendra A Shamanna et al.
Nature communications, 7, 13785-13785 (2016-12-07)
Werner syndrome (WS) is an accelerated ageing disorder with genomic instability caused by WRN protein deficiency. Many features seen in WS can be explained by the diverse functions of WRN in DNA metabolism. However, the origin of the large genomic
B Wang et al.
Cell death and differentiation, 21(7), 1160-1169 (2014-04-29)
Mcl-1 is a unique antiapoptotic Bcl2 family member with a short half-life due to its rapid turnover through ubiquitination. We discovered that Ku70, a DNA double-strand break repair protein, functions as a deubiquitinase to stabilize Mcl-1. Ku70 knockout in mouse

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service