콘텐츠로 건너뛰기
Merck
모든 사진(1)

Key Documents

EHU226031

Sigma-Aldrich

MISSION® esiRNA

targeting human IRF9, RP11-468E2.4

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

100

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

CCAGCTGTCTGGAAGACTCGCCTGCGCTGTGCACTCAACAAGAGTTCTGAATTTAAGGAGGTTCCTGAGAGGGGCCGCATGGATGTTGCTGAGCCCTACAAGGTGTATCAGTTGCTGCCACCAGGAATCGTCTCTGGCCAGCCAGGGACTCAGAAAGTACCATCAAAGCGACAGCACAGTTCTGTGTCCTCTGAGAGGAAGGAGGAAGAGGATGCCATGCAGAACTGCACACTCAGTCCCTCTGTGCTCCAGGACTCCCTCAATAATGAGGAGGAGGGGGCCAGTGGGGGAGCAGTCCATTCAGACATTGGGAGCAGCAGCAGCAGCAGCAGCCCTGAGCCACAGGAAGTTACAGACACAACTGAGGCCCCCTTTCAAGGGGATCAGAGGTCCCTGGAGTTTCTGCTTCCTCCAGAGC

Ensembl | 인체 수납 번호

ENSG00000213928

NCBI 수납 번호

NM_006084

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... IRF9(10379) , IRF9(10379)

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Nicholas Hernandez et al.
The Journal of experimental medicine, 215(10), 2567-2585 (2018-08-26)
Life-threatening pulmonary influenza can be caused by inborn errors of type I and III IFN immunity. We report a 5-yr-old child with severe pulmonary influenza at 2 yr. She is homozygous for a loss-of-function IRF9 allele. Her cells activate gamma-activated
Nadiia Lypova et al.
Cancers, 11(5) (2019-05-19)
While clinical responses to palbociclib have been promising, metastatic breast cancer remains incurable due to the development of resistance. We generated estrogen receptor-positive (ER+) and ER-negative (ER-) cell line models and determined their permissiveness and cellular responses to an oncolytic
Adriana Forero et al.
Immunity, 51(3), 451-464 (2019-09-01)
Type I and III interferons (IFNs) activate similar downstream signaling cascades, but unlike type I IFNs, type III IFNs (IFNλ) do not elicit strong inflammatory responses in vivo. Here, we examined the molecular mechanisms underlying this disparity. Type I and III
Marieke C Verweij et al.
PLoS pathogens, 11(5), e1004901-e1004901 (2015-05-15)
Varicella zoster virus (VZV) causes chickenpox in humans and, subsequently, establishes latency in the sensory ganglia from where it reactivates to cause herpes zoster. Infection of rhesus macaques with simian varicella virus (SVV) recapitulates VZV pathogenesis in humans thus representing

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.