콘텐츠로 건너뛰기
Merck
모든 사진(1)

Key Documents

EHU159851

Sigma-Aldrich

MISSION® esiRNA

targeting human CD209

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

100

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

AGGTCCCCAGCTCCATAAGTCAGGAACAATCCAGGCAAGACGCGATCTACCAGAACCTGACCCAGCTTAAAGCTGCAGTGGGTGAGCTCTCAGAGAAATCCAAGCTGCAGGAGATCTACCAGGAGCTGACCCAGCTGAAGGCTGCAGTGGGTGAGCTTCCAGAGAAATCTAAGCTGCAGGAGATCTACCAGGAGCTGACCCGGCTGAAGGCTGCAGTGGGTGAGCTTCCAGAGAAATCTAAGCTGCAGGAGATCTACCAGGAGCTGACCTGGCTGAAGGCTGCAGTGGGTGAGCTTCCAGAGAAATCTAAGATGCAGGAGATCTACCAGGAGCTGACTCGGCTGAAGGCTGCAGTGGGTGAGCTTCCAGAGA

Ensembl | 인체 수납 번호

ENSG00000090659

NCBI 수납 번호

NM_001144893

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... CD209(30835) , CD209(30835)

관련 카테고리

일반 설명

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Jian Wu et al.
Frontiers in immunology, 9, 1847-1847 (2018-08-29)
By shaping T cell immunity, tolerogenic dendritic cells (tDCs) play critical roles in the induction of immune tolerance after transplantation. However, the role of long noncoding RNAs (lncRNAs) in the function and immune tolerance of dendritic cells (DCs) is largely
Yanmei Jiang et al.
PloS one, 9(12), e114748-e114748 (2014-12-17)
Colon cancer has always been diagnosed at a late stage, which is associated with poor prognosis. The currently used serum tumor markers CEA and CA19-9 display low sensitivity and specificity and may not have diagnostic value in early stage colon
Zoltan Beck et al.
PloS one, 8(11), e81002-e81002 (2013-11-28)
Chronic HIV-1 infection is associated with persistent viremia in most patients, but it remains unclear how free virus may survive the potential hostile effects of plasma. We investigated whether sites might exist on the surfaces of circulating blood cells for
Aiping Liu et al.
PloS one, 9(1), e85176-e85176 (2014-01-24)
Ex vivo foreskin models have demonstrated that inner foreskin is more susceptible to HIV-1 infection than outer foreskin. In the present study we characterized the compartition of HIV-1 target cells and quantified these cells in the epidermis and dermis of
D Feng et al.
Clinical and experimental immunology, 191(1), 107-115 (2017-09-13)
In the pathological process of acute kidney injury (AKI), innate immune receptors are essential in inflammatory response modulation; however, the precise molecular mechanisms are still unclear. Our study sought to demonstrate the inflammatory response mechanisms in renal tubular epithelial cells
모든 관련된 서류 보기

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.