콘텐츠로 건너뛰기
Merck
모든 사진(1)

문서

EHU155921

Sigma-Aldrich

MISSION® esiRNA

targeting human LOX

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

CCCCAAAGAGTGAAAAACCAAGGGACATCAGATTTCTTACCCAGCCGACCAAGATATTCCTGGGAATGGCACAGTTGTCATCAACATTACCACAGTATGGATGAGTTTAGCCACTATGACCTGCTTGATGCCAACACCCAGAGGAGAGTGGCTGAAGGCCACAAAGCAAGTTTCTGTCTTGAAGACACATCCTGTGACTATGGCTACCACAGGCGATTTGCATGTACTGCACACACACAGGGATTGAGTCCTGGCTGTTATGATACCTATGGTGCAGACATAGACTGCCAGTGGATTGATATTACAGATGTAAAACCTGGAAACTATATCCTAAAGGTCAGTGTAAACCCCAGCTACCTGGTTCCTGAATCTGACTATACCAACAATGTTGTGCGCTGTGACAT

Ensembl | 인체 수납 번호

ENSG00000113083

NCBI 수납 번호

NM_002317

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... LOX(4015) , LOX(4015)

일반 설명

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

D H Peng et al.
Oncogene, 36(14), 1925-1938 (2016-10-04)
Lung cancer is the leading cause of cancer-related deaths, primarily due to distant metastatic disease. Metastatic lung cancer cells can undergo an epithelial-to-mesenchymal transition (EMT) regulated by various transcription factors, including a double-negative feedback loop between the microRNA-200 (miR-200) family
T Osawa et al.
British journal of cancer, 109(8), 2237-2247 (2013-09-21)
Molecules that are highly expressed in tumour endothelial cells (TECs) may be candidates for specifically targeting TECs. Using DNA microarray analysis, we found that the lysyl oxidase (LOX) gene was upregulated in TECs compared with its expression in normal endothelial
Roozbeh Khosravi et al.
PloS one, 9(6), e100669-e100669 (2014-06-28)
Lysyl oxidase is a multifunctional enzyme required for collagen biosynthesis. Various growth factors regulate lysyl oxidase during osteoblast differentiation, subject to modulation by cytokines such as TNF-α in inflammatory osteopenic disorders including diabetic bone disease. Canonical Wnt signaling promotes osteoblast
Rolf Schreckenberg et al.
Frontiers in physiology, 8, 556-556 (2017-08-22)
Purpose: According to the current therapeutic guidelines of the WHO physical activity and exercise are recommended as first-line therapy of arterial hypertension. Previous results lead to the conclusion, however, that hearts of spontaneously hypertensive rats (SHR) with established hypertension cannot
Roseli da Silva et al.
PloS one, 10(3), e0119781-e0119781 (2015-03-20)
Lysyl oxidase (LOX) is involved in vital biological processes such as cell motility, cell signaling and gene regulation. Deregulation of this protein can contribute to tumor formation and progression. Although it is known that LOX is involved in invasion, proliferation
모든 관련된 서류 보기

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.