콘텐츠로 건너뛰기
Merck
모든 사진(1)

Key Documents

EHU153761

Sigma-Aldrich

MISSION® esiRNA

targeting human EFNB3

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

AGGCAGAGGGTGGTTATGTGCTGTACCCTCAGATCGGGGACCGGCTAGACCTGCTCTGCCCCCGGGCCCGGCCTCCTGGCCCTCACTCCTCTCCTAATTATGAGTTCTACAAGCTGTACCTGGTAGGGGGTGCTCAGGGCCGGCGCTGTGAGGCACCCCCTGCCCCAAACCTCCTTCTCACTTGTGATCGCCCAGACCTGGATCTCCGCTTCACCATCAAGTTCCAGGAGTATAGCCCTAATCTCTGGGGCCACGAGTTCCGCTCGCACCACGATTACTACATCATTGCCACATCGGATGGGACCCGGGAGGGCCTGGAGAGCCTGCAGGGAGGTGTGTGCCTAACCAGAGGCATGAAGGTGCTTCTCCGAGTGGGACAAAGTCCCCGAGGAGGGGCTGTCCCCCGAAAACCTGTGTCTGAAATGCCCATGGAAAGAGA

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Judith Rudolph et al.
Frontiers in cellular neuroscience, 8, 185-185 (2014-08-08)
During embryonic development the preoptic area (POA) gives rise to two populations of neurons which are generated at the same time, cortical interneurons and striatal cells. POA-derived cortical interneurons take a superficial path and avoid the developing striatum (Str) when
Amélie Royet et al.
Oncotarget, 8(14), 23750-23759 (2017-04-21)
EphA4, an Ephrins tyrosine kinase receptor, behaves as a dependence receptor (DR) by triggering cell apoptosis in the absence of its ligand Ephrin-B3. DRs act as conditional tumor suppressors, engaging cell death based on ligand availability; this mechanism is bypassed
Hiroko Sugiura et al.
Nature communications, 6, 6842-6842 (2015-04-17)
Rheb is a small GTP-binding protein and its GTPase activity is activated by the complex of Tsc1 and Tsc2 whose mutations cause tuberous sclerosis complex (TSC). We previously reported that cultured TSC neurons showed impaired spine synapse morphogenesis in an

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.