콘텐츠로 건너뛰기
Merck
모든 사진(1)

Key Documents

EHU151161

Sigma-Aldrich

MISSION® esiRNA

targeting human MZF1

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

GGAGATGGGTCACAGTCCAGGTGCAGGGCCAGGAGGTCCTATCAGAGAAGATGGAGCCCTCCAGTTTCCAGCCCCTACCTGAAACTGAGCCTCCAACTCCAGAGCCTGGGCCCAAGACACCTCCTAGGACTATGCAGGAATCACCACTGGGCCTGCAGGTGAAAGAGGAGTCAGAGGTTACAGAGGACTCAGATTTCCTGGAGTCTGGGCCTCTAGCTGCCACCCAGGAGTCTGTACCCACCCTCCTGCCTGAGGAGGCCCAGAGATGTGGGACCGTGCTGGACCAGATCTTTCCCCACAGCAAGACTGGGCCTGAGGGTCCCTCATGGAGGGAGCACCCCAGGGCCCTGTGGCATGAGGAAGCTGGGGGCATCTTCTCCCCAGGGTTCGCGCTGCAGCTAGGCAGCATCTCCGCAGGTCCAGGTAGTGTAAGCCCTCACCTCCAC

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

C E Weber et al.
Oncogene, 34(37), 4821-4833 (2014-12-23)
Interactions between tumor cells and cancer-associated fibroblasts (CAFs) in the tumor microenvironment significantly influence cancer growth and metastasis. Transforming growth factor-β (TGF-β) is known to be a critical mediator of the CAF phenotype, and osteopontin (OPN) expression in tumors is
Lanfang Wu et al.
The FEBS journal, 284(18), 3000-3017 (2017-07-14)
Tumor metastasis remains a major obstacle for improving overall cancer survival in cervical cancer (CC), which may be due to the existence of tumor microenvironment-related cancer stem cells (CSCs) and epithelial-mesenchymal transition (EMT). The mechanism underlying these processes needs to
Keito Okazaki et al.
Nature communications, 11(1), 5911-5911 (2020-11-22)
Transcriptional dysregulation, which can be caused by genetic and epigenetic alterations, is a fundamental feature of many cancers. A key cytoprotective transcriptional activator, NRF2, is often aberrantly activated in non-small cell lung cancers (NSCLCs) and supports both aggressive tumorigenesis and

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.