콘텐츠로 건너뛰기
Merck
모든 사진(1)

Key Documents

EHU115751

Sigma-Aldrich

MISSION® esiRNA

targeting human PRMT1

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

TGATTATGCGGTGAAGATCGTCAAAGCCAACAAGTTAGACCACGTGGTGACCATCATCAAGGGGAAGGTGGAGGAGGTGGAGCTCCCAGTGGAGAAGGTGGACATCATCATCAGCGAGTGGATGGGCTACTGCCTCTTCTACGAGTCCATGCTCAACACCGTGCTCTATGCCCGGGACAAGTGGCTGGCGCCCGATGGCCTCATCTTCCCAGACCGGGCCACGCTGTATGTGACGGCCATCGAGGACCGGCAGTACAAAGACTACAAGATCCACTGGTGGGAGAACGTGTATGGCTTCGACATGTCTTGCATCAAAGATGTGGCCATTAAGGAGCCCCTAGTGGATGTCGTGGACCCCAAACAGCTGGTCACCAACGCCTGCCTCATAAAGGAGGTGGACATCTATACCGTCAAGGTGGAAGACCTGACC

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Eun-Kyung Moon et al.
The Korean journal of parasitology, 55(2), 109-114 (2017-05-17)
Protein arginine methyltransferase (PRMT) is an important epigenetic regulator in eukaryotic cells. During encystation, an essential process for
Jong-Hyun Nho et al.
Biochemical and biophysical research communications, 530(2), 389-395 (2020-06-14)
Recent studies have revealed that protein arginine methyltransferases (PRMTs) are responsible for diverse neurodegenerative diseases. However, their pathophysiological role in dopaminergic neuronal death in Parkinson's disease (PD) has not been evaluated. In this study, we demonstrated that 1-Methyl-4-phenylpyridinium iodide (MPP+)
H Wei et al.
Neoplasma, 66(6), 918-929 (2019-10-15)
Protein arginine methyltransferase 1 (PRMT1) is dysregulated in a number of human cancers. Herein, we report that PRMT1 expression is directly associated with epithelial-mesenchymal transition (EMT) in hepatic carcinoma cells. Firstly, we find that PRMT1 expression is higher in hepatic
Sreedevi Avasarala et al.
The Journal of biological chemistry, 290(21), 13479-13489 (2015-04-08)
Protein arginine methyl transferase 1 (PRMT1) was shown to be up-regulated in cancers and important for cancer cell proliferation. However, the role of PRMT1 in lung cancer progression and metastasis remains incompletely understood. In the present study, we show that
Weiqi Zhai et al.
Journal of immunology (Baltimore, Md. : 1950), 206(1), 11-22 (2020-11-27)
Protein arginine methyltransferase-1 (PRMT1) is an important epigenetic regulator of cell function and contributes to inflammation and remodeling in asthma in a cell type-specific manner. Disease-specific expression patterns of microRNAs (miRNA) are associated with chronic inflammatory lung diseases, including asthma.

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.