콘텐츠로 건너뛰기
Merck
모든 사진(1)

문서

EHU113521

Sigma-Aldrich

MISSION® esiRNA

targeting human HSPD1

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

TCTGCAAACGGAGACAAAGAAATTGGCAATATCATCTCTGATGCAATGAAAAAAGTTGGAAGAAAGGGTGTCATCACAGTAAAGGCAAGTGATGGAAAAACACTGAATGATGAATTAGAAATTATTGAAGGCATGAAGTTTGATCGAGGCTATATTTCTCCATACTTTATTAATACATCAAAAGGTCAGAAATGTGAATTCCAGGATGCCTATGTTCTGTTGAGTGAAAAGAAAATTTCTAGTATCCAGTCCATTGTACCTGCTCTTGAAATTGCCAATGCTCACCGTAAGCCTTTGGTCATAATCGCTGAAGATGTTGATGGAGAAGCTCTAAGTACACTCGTCTTGAATAGGCTAAAGGTTGGTCTTCAGGTTGTGGCAGTCAAGGCTCCAGGGTTTGGTGACAATAGAAAGAACCAGCTTAAAGATATGGCTATTGCTACTGGTGGTGCAGTGTTTGGAGAAG

Ensembl | 인체 수납 번호

ENSG00000144381

NCBI 수납 번호

NM_002156

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... HSPD1(3329) , HSPD1(3329)

일반 설명

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Bor-Hwang Kang et al.
Scientific reports, 9(1), 8932-8932 (2019-06-22)
Buccal mucosa squamous cell carcinoma (BMSCC) is one of major subsites of oral cancer and is associated with a high rate of metastasis and poor prognosis. Heat shock proteins (HSPs) act as potential prognostic biomarkers in many cancer types. However
Justin F Deniset et al.
Cellular signalling, 47, 44-51 (2018-03-30)
Heat shock protein 60 (Hsp60) is a mediator of stress-induced vascular smooth muscle cell (VSMC) proliferation. This study will determine, first, if the mitochondrial or cytoplasmic localization of Hsp60 is critical to VSMC proliferation and, second, the mechanism of Hsp60
Sharmin Afroz et al.
Virus research, 261, 37-49 (2018-12-15)
The UL47 gene product, VP8, is a major tegument protein of BoHV-1. While VP8 is not essential for virus replication in cell culture, a UL47-deleted virus exhibits a smaller tegument structure and is avirulent in cattle. To obtain pure VP8
Shalini Swaroop et al.
Journal of neuroinflammation, 15(1), 177-177 (2018-06-11)
Interleukin-1β (IL-1β) is one of the most important cytokine secreted by activated microglia as it orchestrates the vicious cycle of inflammation by inducing the expression of various other pro-inflammatory cytokines along with its own production. Microglia-mediated IL-1β production is a
Hiroyuki Hosokawa et al.
The Journal of biological chemistry, 290(21), 13095-13103 (2015-04-12)
Gata3 acts as a master regulator for T helper 2 (Th2) cell differentiation by inducing chromatin remodeling of the Th2 cytokine loci, accelerating Th2 cell proliferation, and repressing Th1 cell differentiation. Gata3 also directly transactivates the interleukin-5 (Il5) gene via

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.