추천 제품
설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
형태
lyophilized powder
esiRNA cDNA 표적 서열
GATGTGCTGCAGAATGAGGAGGGTGAGACCACCAGCCACCTGATGGGCATGTTCTACCGCACCATTCGCATGATGGAGAACGGCATCAAGCCCGTGTATGTCTTTGATGGCAAGCCGCCACAGCTCAAGTCAGGCGAGCTGGCCAAACGCAGTGAGCGGCGGGCTGAGGCAGAGAAGCAGCTGCAGCAGGCTCAGGCTGCTGGGGCCGAGCAGGAGGTGGAAAAATTCACTAAGCGGCTGGTGAAGGTCACTAAGCAGCACAATGATGAGTGCAAACATCTGCTGAGCCTCATGGGCATCCCTTATCTTGATGCACCCAGTGAGGCAGAGGCCAGCTGTGCTGCCCTGGTGAAGGCTGGCAAAGTCTATGCTGCGGCTACCGAGGACATGGACTGCCTCACCTT
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... FEN1(2237) , FEN1(2237)
일반 설명
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
시험 성적서(COA)
제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.
Song-Bai Liu et al.
Combinatorial chemistry & high throughput screening, 22(6), 379-386 (2019-07-06)
Flap endonuclease-1 (FEN1) plays a central role in DNA replication and DNA damage repair process. In mammals, FEN1 functional sites variation is related to cancer and chronic inflammation, and supports the role of FEN1 as a tumor suppressor. However, FEN1
Xue Zeng et al.
Experimental and therapeutic medicine, 14(4), 3265-3272 (2017-09-16)
Trastuzumab has been widely applied as a treatment for human epidermal growth factor 2 (HER2)-overexpressing breast cancer. However, the therapeutic efficacy of trastuzumab is limited. Flap endonuclease 1 (FEN1) is a multifunctional endonuclease that has a crucial role in DNA
Keqiang Zhang et al.
The American journal of pathology, 188(1), 242-251 (2017-10-19)
Flap endonuclease 1 (FEN1) plays a crucial role in both DNA replication and damage repair. In this study, FEN1 expression and its clinical-pathologic significance in non-small-cell lung cancer (NSCLC) was investigated. Quantitative RT-PCR and immunohistochemistry analysis identified that both FEN1
Xue Zeng et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 33(10), 10717-10730 (2019-07-04)
Flap endonuclease 1 (FEN1) is recognized as a pivotal factor in DNA replication, long-patch excision repair, and telomere maintenance. Excessive FEN1 expression has been reported to be closely associated with cancer progression, but the specific mechanism has not yet been
Y Wang et al.
Clinical & translational oncology : official publication of the Federation of Spanish Oncology Societies and of the National Cancer Institute of Mexico, 21(8), 1026-1033 (2019-02-04)
Flap endonuclease 1 (FEN1) is up-regulated by estrogen (17β-estradiol, E2) and related to cisplatin resistance of human breast cancer cells. Letrozole, an aromatase inhibitor, suppresses the change of testosterone into estrogen and is frequently used to treat breast cancer. However
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.