콘텐츠로 건너뛰기
Merck
모든 사진(1)

Key Documents

EHU107711

Sigma-Aldrich

MISSION® esiRNA

targeting human SNW1

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

ATGATCCAGACCTGCAAAGGCCCGATGAAGAAGCTATTAAAGAGATAACAGAAAAGACAAGAGTAGCCTTAGAAAAATCTGTATCACAGAAGGTCGCCGCAGCCATGCCAGTTCGAGCAGCTGACAAATTGGCTCCTGCTCAGTATATCCGATACACACCATCTCAGCAAGGAGTGGCATTCAACTCTGGAGCTAAACAGAGGGTTATTCGGATGGTAGAAATGCAGAAAGATCCAATGGAGCCTCCAAGGTTCAAGATTAATAAGAAAATTCCCCGGGGACCACCTTCTCCTCCTGCGCCTGTCATGCATTCTCCTAGCCGAAAGATGACTGTAAAGGAACAACAAGAGTGGAAGATTCCTCCTTGTATTTCTAACTGGAAAAATGCAAAGGGTTATACAATTCCATTAGACAAACGTCTGGCTGCTGATGGAAGAGGACTACAGACAGTACACATAAATGAAAATTTCGCCAAATTGGCAGAAGCCCTCTACA

Ensembl | 인체 수납 번호

ENSG00000100603

NCBI 수납 번호

NM_012245

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... SNW1(22938) , SNW1(22938)

일반 설명

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Qiao Zhang et al.
Microbes and infection, 22(10), 576-584 (2020-08-18)
The Ski-interacting protein (SNW1) acts as a transcriptional co-regulator associated with mRNA splicing and transcription, cell cycle progression, acute and chronic inflammatory responses, however, its role involved in host antiviral innate immune responses remains to be explored. Here, for the
Shusen Zhang et al.
Molecular and cellular biochemistry, 410(1-2), 1-9 (2015-08-12)
SYF2, also known as p29/NTC31/CBPIN, encodes a nuclear protein that interacts with Cyclin D-type binding-protein 1. SYF2 has been reported to be involved in pre-mRNA splicing and cell cycle regulation. In the present study, we observed that SYF2 was obviously
E M Davies et al.
Oncogene, 34(28), 3711-3727 (2014-09-23)
Glioblastoma is the most common and lethal primary malignant brain tumor in adults. The tumor suppressor gene PTEN is deleted, mutated or hypermethylated in more than 60% of glioblastoma cases resulting in hyperactivation of the phosphoinositide 3-kinase pathway, which leads

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.