콘텐츠로 건너뛰기
Merck
모든 사진(1)

Key Documents

EHU066621

Sigma-Aldrich

MISSION® esiRNA

targeting human ARID1A

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

100

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

CCCTCAAGTCTGGTCTCCTGGCAGAGAGCACATGGGCATTAGATACCATCAACATCCTGCTGTATGATGACAACAGCATCATGACCTTCAACCTCAGTCAGCTCCCAGGGTTGCTAGAGCTCCTTGTAGAATATTTCCGACGATGCCTGATTGAGATCTTTGGCATTTTAAAGGAGTATGAGGTGGGTGACCCAGGACAGAGAACGCTACTGGATCCTGGGAGGTTCAGCAAGGTGTCTAGTCCAGCTCCCATGGAGGGTGGGGAAGAAGAAGAAGAACTTCTAGGTCCTAAACTAGAAGAGGAAGAAGAAGAGGAAGTAGTTGAAAATGATGAGGAGATAGCCTTTTCAGGCAAGGACAAGCCAGCTTCAGAGAATAGTGAGGAGAAGCTGATCAGTAAGTTTGACAAGCTTCCAGTAAAGATCGTACAGAAGAATGATCCATTTGTGGTGGACTGCTCAGA

Ensembl | 인체 수납 번호

ENSG00000117713

NCBI 수납 번호

NM_006015

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... ARID1A(8289) , ARID1A(8289)

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Yu-Chun Tseng et al.
Molecular reproduction and development, 84(12), 1250-1256 (2017-11-28)
Mammalian embryos undergo dramatic epigenetic remodeling that can have a profound impact on both gene transcription and overall embryo developmental competence. Members of the SWI/SNF (Switch/Sucrose non-fermentable) family of chromatin-remodeling complexes reposition nucleosomes and alter transcription factor accessibility. These large
Dakeun Lee et al.
OncoTargets and therapy, 10, 4153-4159 (2017-09-02)
The At-rich interactive domain 1A (ARID1A) is frequently mutated in gastric cancers (GCs) with a poor prognosis. Growing evidence indicates that loss of ARID1A expression leads to activation of the phosphatidylinositol 3-kinase (PI3K)/AKT pathway by AKT phosphorylation. We aim to
Wen Xiao et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 43(6), 2420-2433 (2017-10-27)
We previously performed microRNA (miRNA) microarray to identify effective indicators of clear cell renal cell carcinoma (ccRCC) tissue samples and preoperative/postoperative plasma in which we identified miR-144-3p as an oncomiRNA. However, the molecular mechanism of miR-144-3p remains unclear. This study
Nan Wang et al.
Gynecologic oncology, 134(1), 129-137 (2014-05-06)
MicroRNAs(miRNAs) play important roles in tumor development and progression. The purposes of this study were to investigate the role of miR-31 in cervical cancer and clarified the regulation of ARID1A by miR-31. Quantitative RT-PCR was used to examine miR-31 expression
Saravana P Selvanathan et al.
Nucleic acids research, 47(18), 9619-9636 (2019-08-09)
Connections between epigenetic reprogramming and transcription or splicing create novel mechanistic networks that can be targeted with tailored therapies. Multiple subunits of the chromatin remodeling BAF complex, including ARID1A, play a role in oncogenesis, either as tumor suppressors or oncogenes.
모든 관련된 서류 보기

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.