설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
CATGAACTCGGCCATTCTCTTGGACTCTCCCATTCTACTGATATCGGGGCTTTGATGTACCCTAGCTACACCTTCAGTGGTGATGTTCAGCTAGCTCAGGATGACATTGATGGCATCCAAGCCATATATGGACGTTCCCAAAATCCTGTCCAGCCCATCGGCCCACAAACCCCAAAAGCGTGTGACAGTAAGCTAACCTTTGATGCTATAACTACGATTCGGGGAGAAGTGATGTTCTTTAAAGACAGATTCTACATGCGCACAAATCCCTTCTACCCGGAAGTTGAGCTCAATTTCATTTCTGTTTTCTGGCCACAACTGCCAAATGGGCTTGAAGCTGCTTACGAATTTGCCGACAGAGATGAAGTCCGGTTTTTCAAAGGGAATAAGTACTGGGCTGTTCAGGGACAGAATGTGCTACACGGATACCCCAAGGA
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... MMP1(4312) , MMP1(4312)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Shuichi Shimada et al.
Journal of dermatological science, 100(3), 183-191 (2020-10-16)
Systemic sclerosis (SSc) is characterized by excessive deposition of collagen in the skin and internal organs. Recent studies have shown that chemokine (C-X-C motif) ligands (CXCLs) are involved in the pathogenesis of SSc. Our aim was to examine the anti-fibrotic
Ching-Ju Shen et al.
PloS one, 12(3), e0174487-e0174487 (2017-03-24)
High matrix metalloproteinase 1 (MMP1) expression is associated with enhanced breast cancer growth and metastasis and also might predict poor prognosis. In this study, we further investigated the functional role of MMP1 and how it is upregulated in multi-drug resistant
Elisa Roztocil et al.
Scientific reports, 10(1), 8477-8477 (2020-05-23)
Thyroid eye disease (TED) affects 25-50% of patients with Graves' Disease. In TED, collagen accumulation leads to an expansion of the extracellular matrix (ECM) which causes destructive tissue remodeling. The purpose of this study was to investigate the therapeutic potential
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.