Skip to Content
Merck
All Photos(1)

Key Documents

EHU062901

Sigma-Aldrich

MISSION® esiRNA

targeting human CHD4

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GATGCTGACGCATCTAGTGGTGCGGCCTGGGCTGGGCTCCAAGACTGGATCTATGTCCAAACAGGAGCTTGATGATATCCTCAAATTTGGCACTGAGGAACTATTCAAGGATGAAGCCACTGATGGAGGAGGAGACAACAAAGAGGGAGAAGATAGCAGTGTTATCCACTACGATGATAAGGCCATTGAACGGCTGCTAGACCGTAACCAGGATGAGACTGAAGACACAGAATTGCAGGGCATGAATGAATATTTGAGCTCATTCAAAGTGGCCCAGTATGTGGTACGGGAAGAAGAAATGGGGGAGGAAGAGGAGGTAGAACGGGAAATCATTAAACAGGAAGAAAGTGTGGATCCTGACTACTGGGAGAAATTGCTGCGGCACCATTATGAGCAGCAGCAAGAAGATCTAGCCCG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Poyil Pratheeshkumar et al.
International journal of molecular sciences, 22(2) (2021-01-10)
Chromodomain-helicase-DNA-binding protein 4 (CHD4), a core subunit of the nucleosome remodeling and deacetylation (NuRD) complex is highly expressed in several cancers. However, its role in the pathogenesis and progression of papillary thyroid carcinoma (PTC) has not been investigated. We investigated
Zhongliang Zhao et al.
Nucleic acids research, 44(17), 8144-8152 (2016-06-04)
Attenuation of ribosome biogenesis in suboptimal growth environments is crucial for cellular homeostasis and genetic integrity. Here, we show that shutdown of rRNA synthesis in response to elevated temperature is brought about by mechanisms that target both the RNA polymerase
Artem K Velichko et al.
Nucleic acids research, 47(13), 6811-6825 (2019-05-23)
The contribution of nucleoli to the cellular stress response has been discussed for over a decade. Stress-induced inhibition of RNA polymerase I-dependent transcription is hypothesized as a possible effector program in such a response. In this study, we report a

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service