Skip to Content
Merck
All Photos(1)

Key Documents

Safety Information

EHU218531

Sigma-Aldrich

MISSION® esiRNA

targeting human GPX1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CGCCAAGAACGAAGAGATTCTGAATTCCCTCAAGTACGTCCGGCCTGGTGGTGGGTTCGAGCCCAACTTCATGCTCTTCGAGAAGTGCGAGGTGAACGGTGCGGGGGCGCACCCTCTCTTCGCCTTCCTGCGGGAGGCCCTGCCAGCTCCCAGCGACGACGCCACCGCGCTTATGACCGACCCCAAGCTCATCACCTGGTCTCCGGTGTGTCGCAACGATGTTGCCTGGAACTTTGAGAAGTTCCTGGTGGGCCCTGACGGTGTGCCCCTACGCAGGTACAGCCGCCGCTTCCAGACCATTGACATCGAGCCTGACATCGAAGCCCTGCTGTCTCAAGGGCCCAGCTGTGCCTAGGGCGCCCCTCCTACCCCGGCTGCTTGGCAGTTGCAGTGCTGCTGTCTCGGGGGGGTTTTCATCTATGAGGGTGTTTCCTCTAAACCTACGAGGGAGGAACACCTGATCTTACAGAAAATACCACCTCGAGATGGGTGCTGGTCCTGTTGATCCCAGT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Regulatory Listings

Regulatory Listings are mainly provided for chemical products. Only limited information can be provided here for non-chemical products. No entry means none of the components are listed. It is the user’s obligation to ensure the safe and legal use of the product.

JAN Code

EHU218531-50UG:
EHU218531-20UG:


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Zhiquan Huang et al.
International journal of oncology, 48(3), 1271-1279 (2016-01-20)
1,25-Dihydroxyvitamin D3 (1,25D3) is the active form of vitamin D with antineoplastic effects. The glutathione peroxidase-1 (GPX1) gene is associated with tumour progression. The present study aimed to explore the role of GPX1 in 1,25D3-mediated progression of salivary adenoid cystic
Yukari Nakano et al.
Metallomics : integrated biometal science, 12(11), 1693-1701 (2020-09-15)
Excessive zinc ion (Zn2+) release is induced in pathological situations and causes neuronal cell death. Previously, we have reported that copper ions (Cu2+) markedly exacerbated Zn2+-induced neuronal cell death by potentiating oxidative stress, the endoplasmic reticulum (ER) stress response, and
Yongmin Yan et al.
Molecular therapy : the journal of the American Society of Gene Therapy, 25(2), 465-479 (2017-01-17)
Exosomes are small biological membrane vesicles secreted by various cells, including mesenchymal stem cells (MSCs). We previously reported that MSC-derived exosomes (MSC-Ex) can elicit hepatoprotective effects against toxicant-induced injury. However, the success of MSC-Ex-based therapy for treatment of liver diseases
Xiangfeng Gan et al.
International journal of clinical and experimental medicine, 7(9), 2530-2540 (2014-10-31)
Esophageal cancer is one of the most common cancers worldwide. Despite recent progress in the development of novel therapies, esophageal carcinoma remains an aggressive cancer associated with a poor prognosis. The glutathione peroxidase 1 (GPX1) gene located on chromosome 3p21.3
Sui Peng et al.
American journal of physiology. Gastrointestinal and liver physiology, 307(2), G129-G139 (2014-05-24)
Hydrophobic bile acids like deoxycholic acid (DCA), which cause oxidative DNA damage and activate NF-κB in Barrett's metaplasia, might contribute to carcinogenesis in Barrett's esophagus. We have explored mechanisms whereby ursodeoxycholic acid (UDCA, a hydrophilic bile acid) protects against DCA-induced

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service