Select a Size
US$33.28
Estimated to ship on05 May 2025
Select a Size
About This Item
US$33.28
Estimated to ship on05 May 2025
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TTGTGTATTGCGGCAAGAAGGCCCAGCTCAACATTGGCAATGTGCTCCCTGTGGGCACCATGCCTGAGGGTACAATCGTGTGCTGCCTGGAGGAGAAGCCTGGAGACCGTGGCAAGCTGGCCCGGGCATCAGGGAACTATGCCACCGTTATCTCCCACAACCCTGAGACCAAGAAGACCCGTGTGAAGCTGCCCTCCGGCTCCAAGAAGGTTATCTCCTCAGCCAACAGAGCTGTGGTTGGTGTGGTGGCTGGAGGTGGCCGAATTGACAAACCCATCTTGAAGGCTGGCCGGGCGTACCACAAATATAAGGCAAAGAGGAACTGCTGGCCACGAGTACGGGGTGTGGCCATGAATCCTGTGGAGCATCCTTTTGGAGGTGGCAACCACCAGCACATCGGCAAGCCCTCCACCATCCGCAGAGATGCCCCTGCTGGCCGCAAAGTGGGTCTCATTGCTGC
Ensembl | human accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... RPL8(6132) , AF235103.4-201(6132)
1 of 4
This Item | SML0652 | SML2226 | SML2731 |
|---|---|---|---|
| form powder | form powder | form powder | form powder |
| Quality Level 100 | Quality Level 100 | Quality Level - | Quality Level 100 |
| storage temp. 2-8°C | storage temp. 2-8°C | storage temp. 2-8°C | storage temp. 2-8°C |
| solubility H2O: 5 mg/mL, clear (warmed) | solubility DMSO: 5 mg/mL, clear (warmed) | solubility DMSO: 2 mg/mL, clear | solubility DMSO: 2 mg/mL, clear |
| color white to beige | color white to beige | color white to beige | color white to beige |
General description
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
Storage Class Code
10 - Combustible liquids
Flash Point(F)
Not applicable
Flash Point(C)
Not applicable
Choose from one of the most recent versions:
Certificates of Analysis (COA)
It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.
If you need assistance, please contact Customer Support.
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.
Contact Technical Service
