Passa al contenuto
Merck
Tutte le immagini(1)

Key Documents

EMU058651

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Aof2

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

100

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

ACTGCCCTCTGCAAGGAATATGATGAATTAGCTGAAACACAAGGAAAGCTAGAAGAAAAACTTCAAGAATTGGAAGCCAATCCCCCAAGTGATGTATACCTCTCATCAAGAGACAGACAAATACTTGACTGGCATTTTGCAAATCTTGAATTTGCCAACGCCACACCTCTCTCTACCCTCTCTCTTAAACATTGGGATCAGGATGATGACTTTGAGTTTACTGGAAGCCACCTGACAGTAAGGAATGGCTACTCATGTGTGCCTGTGGCTTTAGCTGAAGGCTTGGACATTAAACTGAACACAGCAGTGCGGCAGGTTCGCTACACAGCCTCAGGATGTGAAGTGATTGCTGTGAACACACGTTCCACAAGTCAAACCTTTATTTATAAGTGTGATGCAGTTCTCTGTACACTTCCTTTGGGAGTGTTGAAGCAGCAGCCACCAGCTGTTCAGTTTGTGCCACCTCTTCCTGAGTGGAAAACATCTGCAGTCCAAAGGATGGGATTTGGCAACCTTAACAAGGTGGTGTTATGCTTTGACCGTGTGTTCTGGGACCCAAGT

N° accesso Ensembl | topo

ENSMUSG00000036940

N° accesso NCBI

NM_133872

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

mouse ... AOF2(99982) , Aof2(99982)

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

12 - Non Combustible Liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Melissa M Singh et al.
Neuro-oncology, 17(11), 1463-1473 (2015-03-22)
Glioblastoma (GBM) is the most common and aggressive form of brain cancer. Our previous studies demonstrated that combined inhibition of HDAC and KDM1A increases apoptotic cell death in vitro. However, whether this combination also increases death of the glioma stem
Ghanshyam Upadhyay et al.
Proceedings of the National Academy of Sciences of the United States of America, 111(22), 8071-8076 (2014-05-21)
Lysine-specific demethylase 1 (LSD1) demethylates nucleosomal histone H3 lysine 4 (H3K4) residues in collaboration with the corepressor CoREST/REST corepressor 1 (Rcor1) and regulates cell fates by epigenetically repressing gene targets. The balanced regulation of this demethylase, if any, is however
Stefano Amente et al.
Oncotarget, 6(16), 14572-14583 (2015-06-13)
The chromatin-modifying enzyme lysine-specific demethylase 1, KDM1A/LSD1 is involved in maintaining the undifferentiated, malignant phenotype of neuroblastoma cells and its overexpression correlated with aggressive disease, poor differentiation and infaust outcome. Here, we show that LSD1 physically binds MYCN both in
Sathiya Pandi Narayanan et al.
Cancer letters, 367(2), 162-172 (2015-08-01)
The histone demethylase KDM1A specifically demethylates lysine residues and its deregulation has been implicated in the initiation and progression of various cancers. However, KDM1A's molecular role and its pathological consequences, and prognostic significance in oral cancer remain less understood. In

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.