Passa al contenuto
Merck
Tutte le immagini(1)

Key Documents

EHU109701

Sigma-Aldrich

MISSION® esiRNA

targeting human HSP90B1

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

100

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

AAGGGTGTGGTGGACTCAGATGATCTCCCCTTGAATGTTTCCCGCGAGACTCTTCAGCAACATAAACTGCTTAAGGTGATTAGGAAGAAGCTTGTTCGTAAAACGCTGGACATGATCAAGAAGATTGCTGATGATAAATACAATGATACTTTTTGGAAAGAATTTGGTACCAACATCAAGCTTGGTGTGATTGAAGACCACTCGAATCGAACACGTCTTGCTAAACTTCTTAGGTTCCAGTCTTCTCATCATCCAACTGACATTACTAGCCTAGACCAGTATGTGGAAAGAATGAAGGAAAAACAAGACAAAATCTACTTCATGGCTGGGTCCAGCAGAAAAGAGGCTGAATCTTCTCCATTTGTTGAGCGACTTCTGAAAAAGGGCTATGAAGTTATTTACCTCACAGAACCTGTGGATGAATACTGTATTCAGGCCCTTCCCGAATTTGATGGGAAGAGGTTCCAG

N° accesso Ensembl | uomo

ENSG00000166598

N° accesso NCBI

NM_003299

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... HSP90B1(7184) , HSP90B1(7184)

Descrizione generale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Pedro Buc Calderon et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 105, 115-120 (2018-06-01)
Grp94 plays an essential role in protein assembly. We previously suggested that Grp94 overexpression is involved in tumor aggressiveness. However, the underlying mechanisms remain unknown. Since many tumors display high Grp94 levels, we investigated the effects of tumor microenvironment on
Qun Wei et al.
Biochemical and biophysical research communications, 511(1), 92-98 (2019-02-17)
Vascular endothelial cell (VEC) apoptosis takes part in the development of various cardiovascular diseases. Heat shock protein 90 (HSP90) regulates apoptosis through various apoptosis associated client proteins. In previous study, we identified a novel HSP90 inhibitor HCP1 induced apoptosis in
Naiara Santana-Codina et al.
International journal of molecular sciences, 20(16) (2019-08-10)
Metabolic adaptation may happen in response to the pressure exerted by the microenvironment and is a key step in survival of metastatic cells. Brain metastasis occurs as a consequence of the systemic dissemination of tumor cells, a fact that correlates
Sha She et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 48(2), 741-752 (2018-07-20)
C reactive protein (CRP) levels are elevated in many diseases, including malignant tumors and cardiovascular disorders. In this study, the protein interaction network for CRP was evaluated to determine the importance of CRP and its interacting proteins in the molecular
Lipeng Xiong et al.
Journal of proteomics, 182, 34-44 (2018-05-08)
A Disintegrin And Metalloproteinase 12 (ADAM12) is highly expressed in multiple cancers such as breast and cervical cancers and its high expression reduces the overall patient survival rate. ADAM12 has two major splicing variants, the long membrane-anchored form ADAM12L and

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.