Passa al contenuto
Merck
Tutte le immagini(1)

Key Documents

EHU065431

Sigma-Aldrich

MISSION® esiRNA

targeting human KEAP1

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

100

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

ATCGATGGCCACATCTATGCCGTCGGCGGCTCCCACGGCTGCATCCACCACAACAGTGTGGAGAGGTATGAGCCAGAGCGGGATGAGTGGCACTTGGTGGCCCCAATGCTGACACGAAGGATCGGGGTGGGCGTGGCTGTCCTCAATCGTCTCCTTTATGCCGTGGGGGGCTTTGACGGGACAAACCGCCTTAATTCAGCTGAGTGTTACTACCCAGAGAGGAACGAGTGGCGAATGATCACAGCAATGAACACCATCCGAAGCGGGGCAGGCGTCTGCGTCCTGCACAACTGTATCTATGCTGCTGGGGGCTATGATGGTCAGGACCAGCTGAACAGCGTGGAGCGCTACGATGTGGAAACAGAGACGTGGACTTTCGTAGCCCCCATGAAGCACCGGCGAAGTGCCCTGGGGATCACTGTCCACCAGGGGAGAATCTACGTCCTTGGAGGCTATGATGGTCACA

N° accesso Ensembl | uomo

ENSG00000079999

N° accesso NCBI

NM_012289

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... KEAP1(9817) , KEAP1(9817)

Categorie correlate

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Min-Kyun Song et al.
Free radical biology & medicine, 138, 33-42 (2019-05-07)
Transforming growth factor-β (TGF-β) is a potent pathogenic factor of renal injury through the upregulation of extracellular matrix (ECM) expression and facilitation of renal fibrosis. Nuclear factor erythroid 2-like 2 (Nfe2l2; Nrf2), a master regulator of antioxidant and detoxifying systems
Jinqian Liang et al.
Cell death & disease, 10(12), 888-888 (2019-11-27)
Activation of nuclear-factor-E2-related factor 2 (Nrf2) cascade can alleviate dexamethasone (DEX)-induced oxidative injury and death of human osteoblasts. A recent study has shown that phosphoglycerate kinase 1 (PGK1) inhibition/depletion will lead to Kelch-like ECH-associated protein 1 (Keap1) methylglyoxal modification, thereby
Min Cai et al.
Anesthesiology, 126(3), 507-521 (2017-01-04)
The authors have reported that antioxidative effects play a crucial role in the volatile anesthetic-induced neuroprotection. Accumulated evidence shows that endogenous antioxidation could be up-regulated by nuclear factor-E2-related factor 2 through multiple pathways. However, whether nuclear factor-E2-related factor 2 activation
Indira D Pokkunuri et al.
American journal of physiology. Renal physiology, 319(4), F686-F696 (2020-08-25)
Renal proximal tubular apoptosis plays a critical role in kidney health and disease. However, cellular molecules that trigger renal apoptosis remain elusive. Here, we evaluated the effect of inhibiting protein disulfide isomerase (PDI), a critical thioredoxin chaperone protein, on apoptosis
Weixia Sun et al.
Free radical biology & medicine, 108, 840-857 (2017-05-02)
Epigallocatechin gallate (EGCG) is the most abundant and effective green tea catechin and has been reported to attenuate diabetic nephropathy (DN). However, the mechanism by which EGCG ameliorates DN, till now, has remained unclear. EGCG is known as a potent
Visualizza tutti i documenti correlati

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.