Skip to Content
Merck
All Photos(1)

Key Documents

EHU055401

Sigma-Aldrich

MISSION® esiRNA

targeting human BAG1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGCAATGAGAAGCACGACCTTCATGTTACCTCCCAGCAGGGCAGCAGTGAACCAGTTGTCCAAGACCTGGCCCAGGTTGTTGAAGAGGTCATAGGGGTTCCACAGTCTTTTCAGAAACTCATATTTAAGGGAAAATCTCTGAAGGAAATGGAAACACCGTTGTCAGCACTTGGAATACAAGATGGTTGCCGGGTCATGTTAATTGGGAAAAAGAACAGTCCACAGGAAGAGGTTGAACTAAAGAAGTTGAAACATTTGGAGAAGTCTGTGGAGAAGATAGCTGACCAGCTGGAAGAGTTGAATAAAGAGCTTACTGGAATCCAGCAGGGTTTTCTGCCCAAGGATTTGCAAGCTGAAGCTCTCTGCAAACTTGATAGGAGAGTAAAAGCCACAATAGAGCAGTTTATGAAGATCTTGGAGGAGATTGACACACTGATCCTGCCAGAAA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Shutong Liu et al.
Journal of translational medicine, 15(1), 189-189 (2017-09-08)
In order to improve therapy for head and neck squamous cell carcinoma (HNSCC), biomarkers associated with local and/or distant tumor relapses and cancer drug resistance are urgently needed. This study identified a potential biomarker, Bcl-2 associated athanogene-1 (BAG-1), that is
Pelin Ozfiliz Kilbas et al.
Molecular biology reports, 46(1), 847-860 (2019-01-21)
The multifunctional anti-apoptotic Bag-1 protein has important roles in apoptosis, proteasome-mediated degradation, transcriptional regulation, and intracellular signaling. Bag-1 promotes cell survival and proliferation, and is overexpressed in breast cancer. Therefore, Bag-1-targeted therapy might be a promising strategy to treat breast
Zhili Shen et al.
Molecular medicine reports, 17(5), 7435-7441 (2018-03-24)
Cinobufacini is widely used in the treatment of advanced cancers. It has been previously reported that microRNA (miR)‑494 was upregulated in cinobufacini‑treated gastric cancer cells; however, the detailed role of miR‑494 in the anti‑tumor activity of cinobufacini is unclear. The
Pelin Ozfiliz et al.
Cell biochemistry and function, 33(5), 293-307 (2015-07-17)
Bag-1, Bcl-2 associated athanogene-1, is a multifunctional protein that can regulate a wide variety of cellular processes: proliferation, cell survival, transcription, apoptosis and motility. Bag-1 interacts with various targets in the modulation of these pathways; yet molecular details of Bag-1's

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service