Skip to Content
Merck
All Photos(1)

Key Documents

EMU050951

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Ehmt2

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGCCTATGTGGTCAGCTCAGTATCCGATGCTGGTATGACAAGGACGGGCGGCTGCTCCAGGAGTTTAACAAGATCGAGCCCCCCCTGATCTTTGAGTGTAACCAGGCATGCTCCTGCTGGAGAAGCTGCAAGAACCGCGTGGTGCAGAGCGGCATCAAGGTACGGCTGCAGCTCTACCGGACTGCCAAGATGGGCTGGGGGGTCCGAGCCTTGCAGACCATCCCCCAGGGCACGTTCATCTGCGAGTATGTAGGAGAGCTGATCTCTGATGCCGAGGCTGATGTGAGAGAGGATGATTCTTACCTCTTCGATTTAGATAACAAGGATGGCGAGGTTTACTGCATTGATGCCCGTTACTATGGCAACATCAGCCGATTCATTAACCACCTGTGTGACCCCAACATCATCCCTGTCCGGGTTTTCATGCTGCACCAAGA

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Yize Li et al.
Advanced science (Weinheim, Baden-Wurttemberg, Germany), 7(13), 1902402-1902402 (2020-07-17)
Nerve injury-induced change in gene expression in primary sensory neurons of dorsal root ganglion (DRG) is critical for neuropathic pain genesis. N6-methyladenosine (m6A) modification of RNA represents an additional layer of gene regulation. Here, it is reported that peripheral nerve
Shuli Liu et al.
Oncotarget, 6(9), 6887-6901 (2015-03-10)
Head and neck squamous cell carcinoma (HNSCC) is a particularly aggressive cancer with poor prognosis, largely due to lymph node metastasis and local recurrence. Emerging evidence suggests that epithelial-to-mesenchymal transition (EMT) is important for cancer metastasis, and correlated with increased
Kee-Beom Kim et al.
Nucleic acids research, 43(7), 3509-3523 (2015-03-15)
Histone H3K9 methyltransferase (HMTase) G9a-mediated transcriptional repression is a major epigenetic silencing mechanism. UHRF1 (ubiquitin-like with PHD and ring finger domains 1) binds to hemimethylated DNA and plays an essential role in the maintenance of DNA methylation. Here, we provide

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service