Skip to Content
Merck
All Photos(1)

Key Documents

EHU030401

Sigma-Aldrich

MISSION® esiRNA

targeting human MELK

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCAAAACCCAAGGGTAACAAGGATTACCATCTACAGACATGCTGTGGGAGTCTGGCTTATGCAGCACCTGAGTTAATACAAGGCAAATCATATCTTGGATCAGAGGCAGATGTTTGGAGCATGGGCATACTGTTATATGTTCTTATGTGTGGATTTCTACCATTTGATGATGATAATGTAATGGCTTTATACAAGAAGATTATGAGAGGAAAATATGATGTTCCCAAGTGGCTCTCTCCCAGTAGCATTCTGCTTCTTCAACAAATGCTGCAGGTGGACCCAAAGAAACGGATTTCTATGAAAAATCTATTGAACCATCCCTGGATCATGCAAGATTACAACTATCCTGTTGAGTGGCAAAGCAAGAATCCTTTTATTCACCTCGATGATGATTGCGTAACAGAACTTTCTGTACATCACAGAAACAACAGGCAAACAATGGAGGATTTAATTTCACTGTGGCAGTATGATCACCTCACGG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Ke Wang et al.
Oncology reports, 39(6), 2777-2786 (2018-04-06)
Retinoblastoma (Rb) is the most frequent primary intraocular tumor usually diagnosed in infants and children, and current therapy for such disease is still limited. Corosolic acid (CA), an ursane-type pentacyclic triterpene, has been assessed as a promising anticancer agent with little impact
Gang Li et al.
Oncology letters, 15(6), 9934-9940 (2018-05-29)
Maternal embryonic leucine zipper kinase (MELK) is an important regulator in tumorigenesis of human breast cancer, and if silenced leads to programmed cell death in specific breast cancer cell lines, including MDA-MB-231 cells. In the present study, RNA interference, proliferation
Antonio Cigliano et al.
Medicina (Kaunas, Lithuania), 56(1) (2019-12-22)
Background and Objectives: Intrahepatic cholangiocarcinoma (iCCA) is a pernicious tumor characterized by a dismal outcome and scarce therapeutic options. To substantially improve the prognosis of iCCA patients, a better understanding of the molecular mechanisms responsible for development and progression of

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service