Skip to Content
Merck
All Photos(2)

Key Documents

EHU135281

Sigma-Aldrich

MISSION® esiRNA

targeting human BCL2

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CGGCCTCTGTTTGATTTCTCCTGGCTGTCTCTGAAGACTCTGCTCAGTTTGGCCCTGGTGGGAGCTTGCATCACCCTGGGTGCCTATCTGGGCCACAAGTGAAGTCAACATGCCTGCCCCAAACAAATATGCAAAAGGTTCACTAAAGCAGTAGAAATAATATGCATTGTCAGTGATGTACCATGAAACAAAGCTGCAGGCTGTTTAAGAAAAAATAACACACATATAAACATCACACACACAGACAGACACACACACACACAACAATTAACAGTCTTCAGGCAAAACGTCGAATCAGCTATTTACTGCCAAAGGGAAATATCATTTATTTTTTACATTATTAAGAAAAAAAGATTTATTTATTTAAGACAGTCCCATCAAAACTCCTGTCTTTGGAAATCCGACCACTAATTGCCAAGCACC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Ya'nan Yang et al.
OncoTargets and therapy, 12, 897-906 (2019-02-19)
Peritoneal metastasis is the most common pathway for the spread of ovarian cancer. Ovarian cancer cells in ascites prefer to aggregate into the more chemoresistant multicellular spheroids (MCSs), leading to treatment failure and disease recurrence. We previously established a suspension
Jianxu Zhang et al.
International journal of nanomedicine, 12, 4721-4732 (2017-07-26)
Herein, DNA duplex was constructed through the hybridization of adenosine triphosphate (ATP)-responsive aptamer and its cDNA in which GC-rich motif could be used to load doxorubicin (DOX), and then, cationic polymer PEI25K was used as a carrier to simultaneously condense
Kangcheng Zhao et al.
Gene, 628, 259-266 (2017-07-19)
Accumulating evidence indicates that microRNAs can regulate the apoptosis of various cells. Apoptosis of nucleus pulposus cells plays an important role in the progression of intervertebral disc degeneration. The aim of this study is to investigate whether microRNA-143 (miRNA-143) is
Tian-Quan Yang et al.
OncoTargets and therapy, 10, 4305-4313 (2017-09-19)
Glioma is one of the most common types of adult primary brain tumors, and the underlying molecular mechanisms still remain unclear. Nuclear factor-kappa B1 (NF-κB1) is involved in a variety of malignancies and is widely expressed in malignant tumors. However
Gui-Yun Xu et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 92, 95-107 (2017-05-23)
Gastric cancer still presents a significant problem for public health worldwide. Troxerutin (TXN), a flavonoid present in tea, coffee, cereal grains, and a variety of fruits and vegetables, exhibits various pharmacological and biological activities in vitro and in vivo. We

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service