Skip to Content
Merck
All Photos(1)

Key Documents

EHU056141

Sigma-Aldrich

MISSION® esiRNA

targeting human CHEK1

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TTGGGCTATCAATGGAAGAAAAGTTGTATGAATCAGGTTACTATATCAACAACTGATAGGAGAAACAATAAACTCATTTTCAAAGTGAATTTGTTAGAAATGGATGATAAAATATTGGTTGACTTCCGGCTTTCTAAGGGTGATGGATTGGAGTTCAAGAGACACTTCCTGAAGATTAAAGGGAAGCTGATTGATATTGTGAGCAGCCAGAAGATTTGGCTTCCTGCCACATGATCGGACCATCGGCTCTGGGGAATCCTGGTGAATATAGTGCTGCTATGTTGACATTATTCTTCCTAGAGAAGATTATCCTGTCCTGCAAACTGCAAATAGTAGTTCCTGAAGTGTTCACTTCCCTGTTTATCCAAACATCTTCCAATTTATTTTGTTTGTTCGGCATACAAATAATACCTATATCTTAATTGTAAGCAAAACTTTGGGGAAAGG

Ensembl | human accession no.

ENSG00000149554

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... CHEK1(1111) , CHEK1(1111)

Related Categories

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Yan Liu et al.
Cancer research, 77(18), 5068-5076 (2017-07-30)
Cells lacking the tumor suppressor gene
Ming Bai et al.
Cell biology international, 42(7), 781-793 (2017-12-23)
The ATM and Rad3-related (ATR)/checkpoint kinase 1 (Chk1) pathway plays a pivotal role in DNA damage sensor and modulating homologous recombination. Recently, emerging evidence demonstrated that Chk1 phosphorylation was associated with chemotherapy and radiotherapy resistance. In this study, we explored
L M Sarmento et al.
Oncogene, 34(23), 2978-2990 (2014-08-19)
Checkpoint kinase 1 (CHK1) is a key component of the ATR (ataxia telangiectasia-mutated and Rad3-related)-dependent DNA damage response pathway that protect cells from replication stress, a cell intrinsic phenomenon enhanced by oncogenic transformation. Here, we show that CHK1 is overexpressed
Wei-Hsun Hsu et al.
Journal of thoracic oncology : official publication of the International Association for the Study of Lung Cancer, 14(6), 1032-1045 (2019-02-17)
Platinum-based chemotherapy remains the standard treatment for patients with SCLC, but the benefit of the treatment is often hampered by rapid development of drug resistance. Thus far, there is no targeted therapy available for SCLC. More than 90% of SCLC
Lei Duan et al.
Oncogene, 38(28), 5643-5657 (2019-04-11)
Platinum-based drugs such as cisplatin (CP) are the first-line chemotherapy for non-small-cell lung carcinoma (NSCLC). Unfortunately, NSCLC has a low response rate to CP and acquired resistance always occurs. Histone methylation regulates chromatin structure and is implicated in DNA repair.
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service