Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU084971

Sigma-Aldrich

MISSION® esiRNA

targeting human ILF3

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TGGCATTTATGACCCTTGTGAAAAAGAAGCCACTGATGCTATTGGGCATCTAGACAGACAGCAACGGGAAGATATCACACAGAGTGCGCAGCACGCACTGCGGCTCGCTGCCTTCGGCCAGCTCCATAAAGTCCTAGGCATGGACCCTCTGCCTTCCAAGATGCCCAAGAAACCAAAGAATGAAAACCCAGTGGACTACACCGTTCAGATCCCACCAAGCACCACCTATGCCATTACGCCCATGAAACGCCCAATGGAGGAGGACGGGGAGGAGAAGTCGCCCAGCAAAAAGAAGAAGAAGATTCAGAAGAAAGAGGAGAAGGCAGAGCCCCCCCAGGCTATGAATGCCCTGATGCGGTTGAACCAGCTGAAGCCAGGGCTGCAGTACAAGCTGGTGTCCCA

Numéro d'accès Ensembl | humain

ENSG00000129351

Numéro d'accès NCBI

NM_012218

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... ILF3(3609) , ILF3(3609)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

M Laura Idda et al.
Nucleic acids research, 46(22), 12040-12051 (2018-10-03)
Polymorphisms in untranslated regions (UTRs) of disease-associated mRNAs can alter protein production. We recently identified a genetic variant in the 3'UTR of the TNFSF13B gene, encoding the cytokine BAFF (B-cell-activating factor), that generates an alternative polyadenylation site yielding a shorter
Tracey W Chan et al.
Genome biology, 21(1), 268-268 (2020-10-28)
RNA editing generates modifications to the RNA sequences, thereby increasing protein diversity and shaping various layers of gene regulation. Recent studies have revealed global shifts in editing levels across many cancer types, as well as a few specific mechanisms implicating
Zejin Pu et al.
Journal of cellular biochemistry, 120(10), 18172-18185 (2019-05-31)
Adenosine is a promising cytotoxic reagent for tumors, long noncoding RNA (lncRNA) maternally expressed gene 3 (MEG3) has been indicated to play critical roles in tumorigenesis, ILF3 has been recognized as a MEG3-binding protein, however, the roles of adenosine and
Rong Jia et al.
RNA (New York, N.Y.), 25(5), 630-644 (2019-02-24)
Alternative RNA splicing is an important focus in molecular and clinical oncology. We report here that SRSF3 regulates alternative RNA splicing of interleukin enhancer binding factor 3 (ILF3) and production of this double-strand RNA-binding protein. An increased coexpression of ILF3

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique