Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU034701

Sigma-Aldrich

MISSION® esiRNA

targeting human ROCK1 (2)

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

AGGACAGAATCGGACACAGCTGTAAGATTGAGGAAGAGTCACACAGAGATGAGCAAGTCAATTAGTCAGTTAGAGTCCCTGAACAGAGAGTTGCAAGAGAGAAATCGAATTTTAGAGAATTCTAAGTCACAAACAGACAAAGATTATTACCAGCTGCAAGCTATATTAGAAGCTGAACGAAGAGACAGAGGTCATGATTCTGAGATGATTGGAGACCTTCAAGCTCGAATTACATCTTTACAAGAGGAGGTGAAGCATCTCAAACATAATCTCGAAAAAGTGGAAGGAGAAAGAAAAGAGGCTCAAGACATGCTTAATCACTCAGAAAAGGAAAAGAATAATTTAGAGATAGATTTAAACTACAAACTTAAATCATTACAACAACGGTTAGAACAAGAGGTAAATGAACACAAAGTAACCAAAGCTCGTTTAACTGACAAACATCAATCTATTGAAGAGGCAAAGTCTGTGGC

Numéro d'accès Ensembl | humain

ENSG00000067900

Numéro d'accès NCBI

NM_005406

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... ROCK1(6093) , ROCK1(6093)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Gentao Fan et al.
Frontiers in bioscience (Landmark edition), 24, 1167-1177 (2019-05-29)
miR-139 has a tumor suppressor effect in many tumors. Here, we examined the suppressive role of this miRNA and its target, ROCK1, in osteosarcoma (OS), a highly malignant bone tumor that mainly affects children and adolescents. The expression of miR-139
Wen-Di Zhou et al.
International journal of oncology, 51(6), 1831-1841 (2017-10-19)
Actein is a tetracyclic triterpenoid compound, extracted from the rhizome of Cimicifuga foetida, exhibiting anticancer activities as previously reported. However, the effects of actein on human leukemia have not been explored before. In this study, the role of actein in
Dongmei Wang et al.
OncoTargets and therapy, 13, 361-370 (2020-02-06)
Propofol has been identified to perform anti-tumor functions in glioma. However, the molecular mechanisms underlying propofol-induced prevention on migration and invasion of glioma cells remain unclear. Cell proliferation, invasion and migration were measured by 3-(4,5)-dimethylthiahiazo(-z-y1)-3,5-di-phenytetrazoliumromide assay and transwell assay, respectively.
Yong Wang et al.
Molecular cancer, 17(1), 89-89 (2018-05-14)
Accumulating evidences indicate that non-coding RNAs (ncRNAs) including long non-coding RNAs (lncRNAs) and microRNAs (miRNAs) acting as crucial regulators in osteosarcoma (OS). Previously, we reported that Rho associated coiled-coil containing protein kinase 1 (ROCK1), a metastatic-related gene was negatively regulated
Clarissa N Amaya et al.
BMC cancer, 17(1), 485-485 (2017-07-16)
The serine/threonine protein kinases ROCK1 and 2 are key RhoA-mediated regulators of cell shape and cytoskeletal dynamics. These proteins perform multiple functions in vascular endothelial cell physiology and are attractive targets for cancer therapy based on their roles as oncogenes
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique