Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EMU090681

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Xrn1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TGGGAAAGGCAGTCTTTGTTAACTGGCCTCATCTTGAAGAAGCTAGAGTTGTGGCAGTATCAGATGGTGAAACTAAGTTTTACATAGAAGAACCTCCAGGAACACAGAAGGTTTATTTGGGAAAAACTGCCCCACCATCTAAAGTCATCCAACTTACAGATAAAGAACAATCGAACTGGACTAAAGAAATACAAGGAATTTCAGAACAATATCTAAGAAGAAAGGGAATAATAATAAATGAAACATCTGCTGTTGTGTATGCTCAGTTGCTCACGGGTCGTAAATATCAAATCAGTCAGAATGGTGAAGTTCGTCTAGAAAAACAGTGGTCAAAACAAATTCTTCCTTTTGTTTATCAAACTATTGTTAAGGACATCCGAGCTTTTGACTCTCGTTTCTCCAATATCAAGACATTGGATGACTTGTTTCCACCGAGAACTATGGTCTTTATGCTTGGAACTCCTTATTATGGCTGCACTGGAGAAGTTCAGGATTCAGGAGACTTGATTACAGAAGGGAGAATTCGTGTGGTTTTCAGCATTCCATGTGAGCCAAATCTTGATGC

Ensembl | nº de acceso | ratón

ENSMUSG00000032410

Nº de acceso NCBI

NM_011916

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

mouse ... XRN1(24127) , Xrn1(24127)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Shin-Ichiro Hori et al.
Biochemical and biophysical research communications, 464(2), 506-511 (2015-07-15)
Antisense oligonucleotides (ASOs) can suppress the expression of a target gene by cleaving pre-mRNA and/or mature mRNA via RNase H1. Following the initial endonucleolytic cleavage by RNase H1, the target RNAs are degraded by a mechanism that is poorly understood.
Oussama Meziane et al.
Scientific reports, 5, 16688-16688 (2015-11-21)
The decapping scavenger enzyme DcpS is known for its role in hydrolyzing the cap structure following mRNA degradation. Recently, we discovered a new function in miRNA degradation activation for the ortholog of DcpS in C. elegans. Here we show that

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico