Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EMU074401

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Tmprss4

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CCAAGGTCACTGCCTATCTCAACTGGATCTACAATGTTCGGAAGTCTGAGATGTAACGCTGCCGTCCCCCACATCCAGAAGCTGCTTCCCTTCAGACCTACCTACGGCATGACCCCTCAAAGTCAGATATGGGACAAGAGCCTCCTTGAACAAACTCTGGTATCCCTGCAGCAAGCAAGGATACATTGCAGAGGTGCCCGGAGTGGAGTCAGATGGGCTAGCTCAGCCACCCCTGCATCTCCCAAACCCTGGGAGACATGTGGCCCATGGGAGTAAATCCAGGACATTGACTCAACTCTCAGAAGTGTTATTCAGTCAAGGAGGCTCTCCCTTCCACTGAAGGAAGGAAAGTCAGCTCTCTCCTGAAAGGCCAGATCACTGGCTGAGTAGATGAGACAAGGGTATGAAAGGCCTTTGCCATCTTCTTTGCCCAGTCCTGAA

Ensembl | nº de acceso | ratón

ENSMUSG00000032091

Nº de acceso NCBI

NM_145403

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

mouse ... TMPRSS4(214523) , Tmprss4(214523)

Categorías relacionadas

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Cheng-Hao Wang et al.
Scientific reports, 5, 12366-12366 (2015-07-21)
TMPRSS4 (Transmembrane protease serine 4) is up-regulated in a broad spectrum of cancers. However, little is known about the biological effects of TMPRSS4 on hepatocellular carcinoma (HCC) and the related mechanisms. In the present study, we found that overexpression of
Dan Zhang et al.
Oncology reports, 35(1), 81-88 (2015-11-05)
Overexpression of transmembrane protease, serine 3 (TMPRSS3) has been detected in ovarian cancer. However, the molecular mechanisms of TMPRSS3 in ovarian cancer remain unclear. In the present study, we found that TMPRSS3 was significantly expressed in ovarian cancer cells. Overexpression

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico