Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EMU071691

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Clk1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GCCTTGCAAGCTTTGTCTTCAGGGTTGGAAAGATGAGACATTCAAAGAGAACTTACTGTCCTGACTGGGATGAAAGAGACTGGGATTATGGAACATGGAGAAGCAGCAGCAGTCACAAAAGAAAGAAGAGATCACATAGCAGCGCCCGTGAGCAAAAGCGCTGCAGGTACGATCACTCCAAAACGACAGACAGCTATTATCTGGAAAGCAGATCCATAAATGAGAAAGCTTATCATAGTCGACGCTATGTTGATGAATACAGGAATGACTACATGGGCTACGAGCCAGGGCATCCCTATGGAGAACCTGGAAGCAGATACCAGATGCATAGTAGCAAGTCCTCTGGTAGGAGTGGAAGAAGCAGTTACAAAAGTAAACACAGGAGTCGCCACCACACATCGCAGCACCATTCACACGGGATGAAATTGTTG

Ensembl | nº de acceso | ratón

ENSMUSG00000026034

Nº de acceso NCBI

NM_009905

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

mouse ... CLK1(12747) , Clk1(12747)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Apiruck Watthanasurorot et al.
PLoS genetics, 9(3), e1003361-e1003361 (2013-04-05)
Daily, circadian rhythms influence essentially all living organisms and affect many physiological processes from sleep and nutrition to immunity. This ability to respond to environmental daily rhythms has been conserved along evolution, and it is found among species from bacteria
Egle Jakubauskiene et al.
The Journal of biological chemistry, 290(29), 18079-18089 (2015-05-30)
The removal of introns from mRNA precursors (pre-mRNAs) is an essential step in eukaryotic gene expression. The splicing machinery heavily contributes to biological complexity and especially to the ability of cells to adapt to altered cellular conditions. Inhibitory PAS domain

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico