Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EMU033061

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Ereg

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CGCTGCTTTGTCTAGGTTCCCACCTTCTACAGGCAGTTATCAGCACAACCGTGATCCCATCATGCATCCCAGGAGAATCCGAGGATAACTGTACCGCCTTAGTTCAGATGGAAGACGATCCCCGTGTGGCTCAAGTGCAGATTACAAAGTGTAGTTCTGACATGGACGGCTACTGCTTGCATGGCCAGTGCATCTACCTGGTGGACATGAGAGAGAAATTCTGCAGATGTGAAGTGGGCTACACTGGTCTGCGATGTGAGCACTTCTTTCTAACTGTTCACCAACCCTTGAGCAAAGAATACGTTGCGTTGACAGTGATTCTCATTTTCCTGTTTCTCATCATAACCGCTGGATGCATATACTATTTCTGCAGATGGTACAAAAATCGAAAAAGTAAAAAATCGAGGGAGGAATATGAGAGAGTGACCTCAGGGGACCCAGTGCTGCCACAGGTCTGAACAGTGCCATCAAGTTACGGA

Ensembl | nº de acceso | ratón

ENSMUSG00000029377

Nº de acceso NCBI

NM_007950

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

mouse ... EREG(13874) , Ereg(13874)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.

Si necesita más asistencia, póngase en contacto con Atención al cliente

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Teresa Elo et al.
Endocrine-related cancer, 21(4), 677-690 (2014-06-19)
Estrogens contribute to the development and growth of the prostate and are implicated in prostate tumorigenesis. In their target tissues, estrogens mediate their effects via estrogen receptor α (ERα (ESR1)) and β (ERβ (ESR2)). Hyperplasia and decreased differentiation of epithelial
Mariya Farooqui et al.
Molecular cancer, 14, 138-138 (2015-07-29)
The epidermal growth factor (EGF) family of ligands has been implicated in promoting breast cancer initiation, growth and progression. The contributions of EGF family ligands and their receptors to breast cancer are complex, and the specific mechanisms through which different
Renlong Zou et al.
International journal of biological sciences, 11(9), 992-1005 (2015-07-30)
Estrogen receptor α (ERα) is a key transcriptional factor in the proliferation and differentiation in mammary epithelia and has been determined to be an important predictor of breast cancer prognosis and therapeutic target. Meanwhile, diverse transcriptional co-regulators of ERα play
Ming-Yue Li et al.
Journal of molecular medicine (Berlin, Germany), 93(11), 1221-1233 (2015-06-05)
Smoking carcinogen N-nitrosamines such as 4-methylnitrosamino-l-3-pyridyl-butanone (NNK) require metabolic activation to exert their genotoxicity. The first activation step is mainly catalyzed by cytochrome P450 (CYP) family. Estrogen receptor α (ERα) plays a role in lung pathology. The association between them
Shang Li et al.
Scientific reports, 5, 16815-16815 (2015-11-17)
Formononetin is an isoflavone that has been shown to display estrogenic properties and induce angiogenesis activities. However, the interrelationship between the estrogenic properties and angiogenesis activities of formononetin are not well defined. In the present study, docking and enzymatic assay

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico