Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EMU012771

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Serpine2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TGGTCCTCGTTAATGCAGTGTATTTCAAGGGTTTGTGGAAGTCTCGGTTTCAACCAGAGAGCACAAAGAAACGGACATTCGTGGCAGGTGATGGGAAATCCTACCAAGTACCCATGTTGGCTCAGCTCTCTGTGTTCCGCTCAGGGTCTACCAGGACCCCGAATGGCTTATGGTACAACTTCATTGAGCTGCCCTACCATGGTGAGAGCATCAGCATGCTGATCGCCCTGCCAACAGAGAGCTCCACCCCACTGTCTGCCATCATCCCTCACATCACTACCAAGACCATTGATAGCTGGATGAACACCATGGTACCCAAGAGGATGCAGCTGGTCCTACCCAAGTTCACAGCTGTGGCACAAACAGATCTGAAGGAGCCACTGAAAGCCCTTGGCATTACTGAGATGTTTGAGCCATCAAAGGC

Ensembl | nº de acceso | ratón

ENSMUSG00000026249

Nº de acceso NCBI

NM_009255

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

mouse ... SERPINE2(20720) , Serpine2(20720)

Categorías relacionadas

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

En-Dong Zhu et al.
PloS one, 9(8), e106049-e106049 (2014-08-30)
Gastric cancer is one of the most common malignant diseases worldwide. Emerging evidence has shown that microRNAs (miRNAs) are associated with tumor development and progression. Our previous studies have revealed that H. pylori infection was able to induce the altered
Kun Wang et al.
Journal of cancer research and clinical oncology, 141(5), 805-812 (2014-11-02)
Altered expression of serine protease inhibitor peptidase inhibitor clade E member 2 (SERPINE2) associates with human cancer development and progression; thus, this study investigated SERPINE2 expression in gastric cancer tissues for association with clinicopathological and survival data from the patients
Ruozhi Zhao et al.
Journal of leukocyte biology, 95(6), 941-949 (2014-02-06)
Diabetes mellitus accelerates the development of atherosclerotic cardiovascular diseases. Monocyte adhesion is an early cellular event of atherogenesis. Elevated levels of glyLDL were common in diabetic patients. Our previous studies indicated that HSF1 and p22-phox (a subunit of the NOX

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico