Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU097271

Sigma-Aldrich

MISSION® esiRNA

targeting human MCM7

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

ATGGCACTGAAGGACTACGCGCTAGAGAAGGAAAAGGTTAAGAAGTTCTTACAAGAGTTCTACCAGGATGATGAACTCGGGAAGAAGCAGTTCAAGTATGGGAACCAGTTGGTTCGGCTGGCTCATCGGGAACAGGTGGCTCTGTATGTGGACCTGGACGACGTAGCCGAGGATGACCCCGAGTTGGTGGACTCAATTTGTGAGAATGCCAGGCGCTACGCGAAGCTCTTTGCTGATGCCGTACAAGAGCTGCTGCCTCAGTACAAGGAGAGGGAAGTGGTAAATAAAGATGTCCTGGACGTTTACATTGAGCATCGGCTAATGATG

Ensembl | nº de acceso humano

ENSG00000166508

Nº de acceso NCBI

NM_005916

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... MCM7(4176) , MCM7(4176)

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

E P Erkan et al.
Oncogene, 33(39), 4778-4785 (2013-10-30)
Minichromosome maintenance (MCM) proteins are key elements that function as a part of the pre-replication complex to initiate DNA replication in eukaryotes. Consistent with their roles in initiating DNA replication, overexpression of MCM family members has been observed in several
Wenjie Li et al.
Molecular medicine reports, 14(6), 5334-5342 (2016-10-26)
Simvastatin (SIM), a 3-hydroxy-3-methylglutaryl coenzyme A reductase inhibitor, has been reported to inhibit the activity of hepatitis B virus (HBV), however, the mechanism underlying its antiviral function remains unknown. Minichromosome maintenance (MCM) 7, a component of the MCM complex, has been reported to
Kyle M Kovary et al.
Molecular systems biology, 14(5), e7997-e7997 (2018-05-16)
Due to noise in the synthesis and degradation of proteins, the concentrations of individual vertebrate signaling proteins were estimated to vary with a coefficient of variation (CV) of approximately 25% between cells. Such high variation is beneficial for population-level regulation
Xu Zhang et al.
Oncology reports, 33(5), 2599-2605 (2015-03-05)
Human non-small cell lung carcinoma (NSCLC) is one of the most common cancer worldwide. In previous studies, lovastatin, acting as an inhibitor of 3-hydroxy-3-methylglutaryl Co A (HMG-CoA) reductase, exhibited significant antitumor activity during tumorigenesis. However, whether or not this effect

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico