Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU069931

Sigma-Aldrich

MISSION® esiRNA

targeting human BTRC

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

AGCTGTGCCAGACTCTGCTTAAACCAAGAAACAGTATGTTTAGCAAGCACTGCTATGAAGACTGAGAATTGTGTGGCCAAAACAAAACTTGCCAATGGCACTTCCAGTATGATTGTGCCCAAGCAACGGAAACTCTCAGCAAGCTATGAAAAGGAAAAGGAACTGTGTGTCAAATACTTTGAGCAGTGGTCAGAGTCAGATCAAGTGGAATTTGTGGAACATCTTATATCCCAAATGTGTCATTACCAACATGGGCACATAAACTCGTATCTTAAACCTATGTTGCAGAGAGATTTCATAACTGCTCTGCCAGCTCGGGGATTGGATCATATTGCTGAGAACATTCTGTCATACCTGGATGCCAAATCACTATGTGCTGCTGAACTTGTGTGCAAGGAATGGTACCGAGTG

Ensembl | nº de acceso humano

ENSG00000166167

Nº de acceso NCBI

NM_003939

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... BTRC(8945) , BTRC(8945)

Categorías relacionadas

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Kazunori Hashimoto et al.
Antioxidants & redox signaling, 25(17), 953-964 (2016-06-02)
Nuclear factor erythroid 2 (NF-E2)-related factor 2 (Nrf2) is the master transcriptional regulator of antioxidant gene expression. On increased oxidative stress, an adaptor for Nrf2 degradation, Kelch-like ECH-associated protein 1 (Keap1), is directly modulated by oxidants in the cytoplasm, which
Zhitian Shi et al.
Digestive diseases and sciences, 61(3), 785-794 (2015-11-02)
There is increasing evidence that histidine triad nucleotide-binding protein 1 (HINT1) is a novel tumor suppressor. In the present study, we investigated the mechanism by which HINT1 promotes the stability of inhibitor of NF-κB α (IκBα) in the cytoplasm of
Qijia Yan et al.
Oncotarget, 6(39), 41766-41782 (2015-10-27)
Epstein-Barr virus (EBV) infection is closely associated with tumorigenesis and development of nasopharyngeal carcinoma (NPC), but the underlying molecular mechanisms remain poorly understood. It has been recently reported that EBV encodes 44 mature miRNAs, some of which were found to

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico