Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU062441

Sigma-Aldrich

MISSION® esiRNA

targeting human SEPT9

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

AGCCAGGAGGCCACTGAGGCGGCTCCCAGCTGCGTTGGCGACATGGCCGACACCCCCAGAGATGCCGGGCTCAAGCAGGCGCCTGCATCACGGAACGAGAAGGCCCCGGTGGACTTCGGCTACGTGGGGATTGACTCCATCCTGGAGCAGATGCGCCGGAAGGCCATGAAGCAGGGCTTCGAGTTCAACATCATGGTGGTCGGGCAGAGCGGCTTGGGTAAATCCACCTTAATCAACACCCTCTTCAAATCCAAAATCAGCCGGAAGTCGGTGCAGCCCACCTCAGAGGAGCGCATCCCCAAGACCATCGAGATCAAGTCCATCACGCACGATATTGAGGAGAAAGGCGTCCGGATGAAGCTGACAGTGATTGACACACCAGGGTTCGGGGACCACATCAACAACGAGAACTGCTGG

Ensembl | nº de acceso humano

ENSG00000184640

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... SEPT9(10801) , SEPT9(10801)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Beatrice Stubendorff et al.
Journal of cancer research and clinical oncology, 145(4), 811-820 (2019-01-04)
In this study, we aimed to identify a DNA methylation pattern suitable for prognosis assessment of muscle-invasive bladder cancer and to investigate metastasis-associated processes regulated by DNA methylation. Genome-wide methylation analysis was performed on 23 muscle-invasive bladder tumors by microarray
Ilona A Kesisova et al.
The Journal of cell biology, 220(2) (2021-01-09)
The metabolic and signaling functions of lysosomes depend on their intracellular positioning and trafficking, but the underlying mechanisms are little understood. Here, we have discovered a novel septin GTPase-based mechanism for retrograde lysosome transport. We found that septin 9 (SEPT9)

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico