Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU061761

Sigma-Aldrich

MISSION® esiRNA

targeting human CDK2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TGTACCTCCCCTGGATGAAGATGGACGGAGCTTGTTATCGCAAATGCTGCACTACGACCCTAACAAGCGGATTTCGGCCAAGGCAGCCCTGGCTCACCCTTTCTTCCAGGATGTGACCAAGCCAGTACCCCATCTTCGACTCTGATAGCCTTCTTGAAGCCCCCAGCCCTAATCTCACCCTCTCCTCCAGTGTGGGCTTGACCAGGCTTGGCCTTGGGCTATTTGGACTCAGGTGGGCCCTCTGAACTTGCCTTAAACACTCACCTTCTAGTCTTGGCCAGCCAACTCTGGGAATACAGGGGTGAAAGGGGGGAACCAGTGAAAATGAAAGGAAGTTTCAGTATTAGATGCACTTAAGTTAGCCTCCACCACCCTTTCCCCCTTCTCTTAGTTATTGCTGAAGAGGGTTGGTATAAAAATAATTTTAAAAAAGCCTTCCTACACGTTAGATTTGCCGTACCAATCTCTGAATGCCCC

Ensembl | nº de acceso humano

ENSG00000123374

Nº de acceso NCBI

NM_052827

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... CDK2(1017) , CDK2(1017)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Tatyana S Nekova et al.
Cell cycle (Georgetown, Tex.), 15(23), 3203-3209 (2016-11-11)
Small molecule inhibitors targeting CDK1/CDK2 have been clinically proven effective against a variety of tumors, albeit at the cost of profound off target toxicities. To separate potential therapeutic from toxic effects, we selectively knocked down CDK1 or CDK2 in p53
Takeshi Namiki et al.
Cancer research, 75(13), 2708-2715 (2015-04-03)
The AMPK-related kinase NUAK2 has been implicated in melanoma growth and survival outcomes, but its therapeutic utility has yet to be confirmed. In this study, we show how its genetic amplification in PTEN-deficient melanomas may rationalize the use of CDK2
Hendrika A Segeren et al.
Cell reports, 33(9), 108449-108449 (2020-12-03)
E2F transcription factors control the expression of cell-cycle genes. Cancers often demonstrate enhanced E2F target gene expression, which can be explained by increased percentages of replicating cells. However, we demonstrate in human cancer biopsy specimens that individual neoplastic cells display
Narisa Chan et al.
Scientific reports, 5, 11777-11777 (2015-07-01)
The cytoplasmic mutant of nucleophosmin (NPMc) is found approximately in one-third of acute myeloid leukemia (AML) cases and is highly associated with normal karyotype. Whereas previous studies have focused on wtNPM in centrosome duplication, we further elucidate the role of

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico