Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU056141

Sigma-Aldrich

MISSION® esiRNA

targeting human CHEK1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TTGGGCTATCAATGGAAGAAAAGTTGTATGAATCAGGTTACTATATCAACAACTGATAGGAGAAACAATAAACTCATTTTCAAAGTGAATTTGTTAGAAATGGATGATAAAATATTGGTTGACTTCCGGCTTTCTAAGGGTGATGGATTGGAGTTCAAGAGACACTTCCTGAAGATTAAAGGGAAGCTGATTGATATTGTGAGCAGCCAGAAGATTTGGCTTCCTGCCACATGATCGGACCATCGGCTCTGGGGAATCCTGGTGAATATAGTGCTGCTATGTTGACATTATTCTTCCTAGAGAAGATTATCCTGTCCTGCAAACTGCAAATAGTAGTTCCTGAAGTGTTCACTTCCCTGTTTATCCAAACATCTTCCAATTTATTTTGTTTGTTCGGCATACAAATAATACCTATATCTTAATTGTAAGCAAAACTTTGGGGAAAGG

Ensembl | nº de acceso humano

ENSG00000149554

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... CHEK1(1111) , CHEK1(1111)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
ACIU
QWU
SVU
BBU
YHT

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Yan Liu et al.
Cancer research, 77(18), 5068-5076 (2017-07-30)
Cells lacking the tumor suppressor gene
Ming Bai et al.
Cell biology international, 42(7), 781-793 (2017-12-23)
The ATM and Rad3-related (ATR)/checkpoint kinase 1 (Chk1) pathway plays a pivotal role in DNA damage sensor and modulating homologous recombination. Recently, emerging evidence demonstrated that Chk1 phosphorylation was associated with chemotherapy and radiotherapy resistance. In this study, we explored
L M Sarmento et al.
Oncogene, 34(23), 2978-2990 (2014-08-19)
Checkpoint kinase 1 (CHK1) is a key component of the ATR (ataxia telangiectasia-mutated and Rad3-related)-dependent DNA damage response pathway that protect cells from replication stress, a cell intrinsic phenomenon enhanced by oncogenic transformation. Here, we show that CHK1 is overexpressed
Wei-Hsun Hsu et al.
Journal of thoracic oncology : official publication of the International Association for the Study of Lung Cancer, 14(6), 1032-1045 (2019-02-17)
Platinum-based chemotherapy remains the standard treatment for patients with SCLC, but the benefit of the treatment is often hampered by rapid development of drug resistance. Thus far, there is no targeted therapy available for SCLC. More than 90% of SCLC
Lei Duan et al.
Oncogene, 38(28), 5643-5657 (2019-04-11)
Platinum-based drugs such as cisplatin (CP) are the first-line chemotherapy for non-small-cell lung carcinoma (NSCLC). Unfortunately, NSCLC has a low response rate to CP and acquired resistance always occurs. Histone methylation regulates chromatin structure and is implicated in DNA repair.
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico