Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU052041

Sigma-Aldrich

MISSION® esiRNA

targeting human ABCC2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TGCTGAAATTGCTGATCTCCTTTGCAAGTGACCGTGACACATATTTGTGGATTGGATATCTCTGTGCAATCCTCTTATTCACTGCGGCTCTCATTCAGTCTTTCTGCCTTCAGTGTTATTTCCAACTGTGCTTCAAGCTGGGTGTAAAAGTACGGACAGCTATCATGGCTTCTGTATATAAGAAGGCATTGACCCTATCCAACTTGGCCAGGAAGGAGTACACCGTTGGAGAAACAGTGAACCTGATGTCTGTGGATGCCCAGAAGCTCATGGATGTGACCAACTTCATGCACATGCTGTGGTCAAGTGTTCTACAGATTGTCTTATCTATCTTCTTCCTATGGAGAGAGTTGGGACCCTCAGTCTTAGCAGGTGTTGGGGTGATGGTGCTTGTAATCCCA

Ensembl | nº de acceso humano

ENSG00000023839

Nº de acceso NCBI

NM_000392

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... ABCC2(1244) , ABCC2(1244)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Khine Myint et al.
Scientific reports, 9(1), 2245-2245 (2019-02-21)
Oxaliplatin is important for the clinical treatment of colorectal cancer and other gastrointestinal malignancies, but tumour resistance is limiting. Several oxaliplatin transporters were previously identified but their relative contributions to determining oxaliplatin tumour responses and gastrointestinal tumour cell sensitivity to
Andrés E Zucchetti et al.
Molecular biology of the cell, 22(20), 3902-3915 (2011-08-26)
In estradiol 17β-d-glucuronide (E17G)-induced cholestasis, the canalicular hepatocellular transporters bile salt export pump (Abcb11) and multidrug-resistance associated protein 2 (Abcc2) undergo endocytic internalization. cAMP stimulates the trafficking of transporter-containing vesicles to the apical membrane and is able to prevent internalization

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico