Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU041261

Sigma-Aldrich

MISSION® esiRNA

targeting human SLC31A1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TTTCCGGTTTGGTGATCAATACAGCTGGAGAAATGGCTGGAGCTTTTGTGGCAGTGTTTTTACTAGCAATGTTCTATGAAGGACTCAAGATAGCCCGAGAGAGCCTGCTGCGTAAGTCACAAGTCAGCATTCGCTACAATTCCATGCCTGTCCCAGGACCAAATGGAACCATCCTTATGGAGACACACAAAACTGTTGGGCAACAGATGCTGAGCTTTCCTCACCTCCTGCAAACAGTGCTGCACATCATCCAGGTGGTCATAAGCTACTTCCTCATGCTCATCTTCATGACCTACAACGGGTACCTCTGCATTGCAGTAGCAGCAGGGGCCGGTACAGGATACTTCCTCTTCAGCTGGAAGAAGGCAGTGGTAGTGGATATCACAGAGCATTGCCATTGACATCAA

Ensembl | nº de acceso humano

ENSG00000136868

Nº de acceso NCBI

NM_001859

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... SLC31A1(1317) , SLC31A1(1317)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Shun Li et al.
Scientific reports, 5, 12410-12410 (2015-07-16)
Copper, a strictly regulated trace element, is essential for many physiological processes including angiogenesis. Dysregulated angiogenesis has been associated with increased copper in tumors, and thus copper chelators have been used to inhibit tumor angiogenesis. However, it remains unclear whether
Xuemin Wang et al.
PloS one, 10(4), e0125402-e0125402 (2015-05-01)
Cisplatin is one of the first-line platinum-based chemotherapeutic agents for treatment of many types of cancer, including ovary cancer. CTR1 (copper transporter 1), a transmembrane solute carrier transporter, has previously been shown to increase the cellular uptake and sensitivity of

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico