Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU025781

Sigma-Aldrich

MISSION® esiRNA

targeting human COPA

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GGAGTGGTTCCAAGTTTCCAGTATTCAATATGTCATACAATCCAGCAGAAAATGCAGTCCTGCTTTGTACAAGAGCTAGCAATCTAGAGAATAGTACCTATGACCTGTACACCATCCCTAAAGATGCTGACTCCCAGAATCCTGATGCGCCTGAAGGGAAACGATCCTCAGGCCTGACAGCCGTTTGGGTCGCTCGAAATCGGTTTGCTGTCCTAGATCGGATGCATTCGCTTCTGATCAAGAATCTGAAGAATGAGATCACCAAAAAGGTACAGGTGCCCAACTGTGATGAGATCTTCTATGCTGGCACAGGCAATCTCCTGCTTCGAGATGCGGACTCTATCACACTCTTTGACGTACAGCAGAAGCGGACTCTGGCATCTGTGAAGATTTCTAAAGTGAAATACGTTATCTGGTCAGCAGACATGTCACATGTAGCACTACTAGCCAAACACGCCATTGTGATCTGTAACCGCAAACTGGATGCT

Ensembl | nº de acceso humano

ENSG00000122218

Nº de acceso NCBI

NM_001098398

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... COPA(1314) , COPA(1314)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Xinxin Peng et al.
Cancer cell, 33(5), 817-828 (2018-05-01)
Adenosine (A) to inosine (I) RNA editing introduces many nucleotide changes in cancer transcriptomes. However, due to the complexity of post-transcriptional regulation, the contribution of RNA editing to proteomic diversity in human cancers remains unclear. Here, we performed an integrated
Alice Lepelley et al.
The Journal of experimental medicine, 217(11) (2020-07-30)
Heterozygous missense mutations in coatomer protein subunit α, COPA, cause a syndrome overlapping clinically with type I IFN-mediated disease due to gain-of-function in STING, a key adaptor of IFN signaling. Recently, increased levels of IFN-stimulated genes (ISGs) were described in

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico