Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

Otros documentos

EHU020301

Sigma-Aldrich

MISSION® esiRNA

targeting human HDAC11

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GAGCTCAAGTGGTCCTTTGCTGTTGCTACCATCACAGAAATCCCCCCCGTTATCTTCCTCCCCAACTTCCTTGTGCAGAGGAAGGTGCTGAGGCCCCTTCGGACCCAGACAGGAGGAACCATAATGGCGGGGAAGCTGGCTGTGGAGCGAGGCTGGGCCATCAACGTGGGGGGTGGCTTCCACCACTGCTCCAGCGACCGTGGCGGGGGCTTCTGTGCCTATGCGGACATCACGCTCGCCATCAAGTTTCTGTTTGAGCGTGTGGAGGGCATCTCCAGGGCTACCATCATTGATCTTGATGCCCATCAGGGCAATGGGCATGAGCGAGACTTCATGGACGACAAGCGTGTGTACATCATGGATGTCTACAACCGCCACATCTACCCAGGGGACCGCTTTGCCAAGCAGGCCATCAGGCGGAAGGTGGAGCTGGAGTGGGGCACAGAGGATGATGAGTACCTGGATAAGGTGGAGAGGAACATCAAGAAATCCCTCCAGG

Ensembl | nº de acceso humano

ENSG00000163517

Nº de acceso NCBI

NM_024827

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... HDAC11(79885) , HDAC11(79885)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Li Yuan et al.
Journal of molecular and cellular cardiology, 122, 1-10 (2018-08-01)
Immune deregulation is a causative factor in pathogenesis of myocarditis. Histone deacetylases (HDAC) involve multiple biochemical activities in the cell. This study aims to elucidate the role of HDAC11 in the regulation of interleukin (IL)-13-expression in CD4+ T cells of
Ming-Yang Li et al.
Oncotarget, 7(48), 79914-79924 (2016-11-09)
The regulatory B cells (Breg) are important in the body immunity. The differentiation process of Breg is not fully understood yet. Ubiquitin A20 has immune regulatory functions. This study aims to investigate the role of A20 in the regulation of
Shashi Bala et al.
Journal of leukocyte biology, 102(2), 487-498 (2017-06-07)
Inflammation promotes the progression of alcoholic liver disease. Alcohol sensitizes KCs to gut-derived endotoxin (LPS); however, signaling pathways that perpetuate inflammation in alcoholic liver disease are only partially understood. We found that chronic alcohol feeding in mice induced miR-155, an

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico