Saltar al contenido
Merck

EHU015721

Sigma-Aldrich

MISSION® esiRNA

targeting human MKL1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

AGTGAGCGGAAGAATGTGCTACAGTTGAAACTCCAGCAGCGCCGGACCCGGGAAGAACTGGTGAGCCAAGGGATCATGCCGCCTTTGAAAAGTCCAGCCGCATTTCATGAGCAGAGAAGGAGCTTGGAGCGGGCCAGGACAGAGGACTATCTCAAACGGAAGATTCGTTCCCGGCCGGAGAGATCGGAGCTGGTCAGGATGCACATTTTGGAAGAGACCTCGGCTGAGCCATCCCTCCAGGCCAAGCAGCTGAAGCTGAAGAGAGCCAGACTAGCCGATGACCTCAATGAGAAGATTGCACAGAGGCCTGGCCCCATGGAGCTGGTGGAGAAGAACATCCTTCCTGTTGAGTCCAGCCTGAAGGAAGCCATCATTGTGGGCCAGGTGAACTATCCCAAAGTAGCAGACAGCTCTTCCTTCGATGAGG

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

David Gau et al.
Angiogenesis, 20(4), 663-672 (2017-06-24)
De novo synthesis of cytoskeleton-regulatory proteins triggered by the megakaryoblastic leukemia (MKL)/serum response factor (SRF) transcriptional system in response to pro-angiogenic growth factors lies at the heart of endothelial cell (EC) migration (a critical element of angiogenesis) and neovascularization. This
Xu Shiwen et al.
PloS one, 10(5), e0126015-e0126015 (2015-05-09)
In scleroderma (systemic sclerosis, SSc), persistent activation of myofibroblast leads to severe skin and organ fibrosis resistant to therapy. Increased mechanical stiffness in the involved fibrotic tissues is a hallmark clinical feature and a cause of disabling symptoms. Myocardin Related
Philipp Kircher et al.
Science signaling, 8(402), ra112-ra112 (2015-11-12)
Megakaryoblastic leukemia 1 (MKL1) is a coactivator of serum response factor (SRF) that promotes the expression of genes associated with cell proliferation, motility, adhesion, and differentiation-processes that also involve dynamic cytoskeletal changes in the cell. MKL1 is inactive when bound

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico