Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

View All Documentation

EHU011991

Sigma-Aldrich

MISSION® esiRNA

targeting human FER

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GACACCTCATCATGGACACGCTACTTTAGCTAAGGCATGACCAGCAATGAACAGTAGTAAGATATGTGCTGATTAGAAGGCTCACTTGTGCAGTGTGGAGGATAACCAGTGCCTTACAAAATGGGGTTTGGGAGTGACCTGAAGAATTCACATGAAGCAGTGTTAAAATTGCAAGACTGGGAATTACGGTTACTGGAAACAGTAAAGAAATTTATGGCCCTGAGAATAAAAAGTGATAAAGAATATGCATCTACTTTACAGAACCTTTGTAATCAAGTTGATAAGGAAAGTACTGTCCAAATGAATTATGTCAGCAACGTATCCAAGTCTTGGCTACTTATGATTCAGCAGACAGAACAACTTAGTAGGATAATGAAGACACATGCAGAGGACTTGAACTCTGGACCTTTACACAGGCTCACCATGATGA

Ensembl | nº de acceso humano

ENSG00000151422

Nº de acceso NCBI

NM_005246

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... FER(2241) , FER(2241)

Categorías relacionadas

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Ana Lonic et al.
The Journal of cell biology, 220(2) (2021-01-08)
Receptor degradation terminates signaling by activated receptor tyrosine kinases. Degradation of EGFR occurs in lysosomes and requires the switching of RAB5 for RAB7 on late endosomes to enable their fusion with the lysosome, but what controls this critical switching is
Yoav Elkis et al.
Nature communications, 8(1), 940-940 (2017-10-19)
Disruption of the reprogrammed energy management system of malignant cells is a prioritized goal of targeted cancer therapy. Two regulators of this system are the Fer kinase, and its cancer cell specific variant, FerT, both residing in subcellular compartments including
Joanna Stanicka et al.
Oncogene, 37(23), 3131-3150 (2018-03-16)
IGF-1 receptor (IGF-1R) and integrin cooperative signaling promotes cancer cell survival, proliferation, and motility, but whether this influences cancer progression and therapy responses is largely unknown. Here we investigated the non-receptor tyrosine adhesion kinase FES-related (FER), following its identification as

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico