Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

Otros documentos

EHU005681

Sigma-Aldrich

MISSION® esiRNA

targeting human MMP1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CATGAACTCGGCCATTCTCTTGGACTCTCCCATTCTACTGATATCGGGGCTTTGATGTACCCTAGCTACACCTTCAGTGGTGATGTTCAGCTAGCTCAGGATGACATTGATGGCATCCAAGCCATATATGGACGTTCCCAAAATCCTGTCCAGCCCATCGGCCCACAAACCCCAAAAGCGTGTGACAGTAAGCTAACCTTTGATGCTATAACTACGATTCGGGGAGAAGTGATGTTCTTTAAAGACAGATTCTACATGCGCACAAATCCCTTCTACCCGGAAGTTGAGCTCAATTTCATTTCTGTTTTCTGGCCACAACTGCCAAATGGGCTTGAAGCTGCTTACGAATTTGCCGACAGAGATGAAGTCCGGTTTTTCAAAGGGAATAAGTACTGGGCTGTTCAGGGACAGAATGTGCTACACGGATACCCCAAGGA

Ensembl | nº de acceso humano

ENSG00000196611

Nº de acceso NCBI

NM_002421

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... MMP1(4312) , MMP1(4312)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Shuichi Shimada et al.
Journal of dermatological science, 100(3), 183-191 (2020-10-16)
Systemic sclerosis (SSc) is characterized by excessive deposition of collagen in the skin and internal organs. Recent studies have shown that chemokine (C-X-C motif) ligands (CXCLs) are involved in the pathogenesis of SSc. Our aim was to examine the anti-fibrotic
Ching-Ju Shen et al.
PloS one, 12(3), e0174487-e0174487 (2017-03-24)
High matrix metalloproteinase 1 (MMP1) expression is associated with enhanced breast cancer growth and metastasis and also might predict poor prognosis. In this study, we further investigated the functional role of MMP1 and how it is upregulated in multi-drug resistant
Elisa Roztocil et al.
Scientific reports, 10(1), 8477-8477 (2020-05-23)
Thyroid eye disease (TED) affects 25-50% of patients with Graves' Disease. In TED, collagen accumulation leads to an expansion of the extracellular matrix (ECM) which causes destructive tissue remodeling. The purpose of this study was to investigate the therapeutic potential

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico