Skip to Content
Merck
All Photos(1)

Key Documents

EHU099741

Sigma-Aldrich

MISSION® esiRNA

targeting human TMPRSS4

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTGAACAGCCTCGATGTCAAACCCCTGCGCAAACCCCGTATCCCCATGGAGACCTTCAGAAAGGTGGGGATCCCCATCATCATAGCACTACTGAGCCTGGCGAGTATCATCATTGTGGTTGTCCTCATCAAGGTGATTCTGGATAAATACTACTTCCTCTGCGGGCAGCCTCTCCACTTCATCCCGAGGAAGCAGCTGTGTGACGGAGAGCTGGACTGTCCCTTG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Cheng-Hao Wang et al.
Scientific reports, 5, 12366-12366 (2015-07-21)
TMPRSS4 (Transmembrane protease serine 4) is up-regulated in a broad spectrum of cancers. However, little is known about the biological effects of TMPRSS4 on hepatocellular carcinoma (HCC) and the related mechanisms. In the present study, we found that overexpression of
Dan Zhang et al.
Oncology reports, 35(1), 81-88 (2015-11-05)
Overexpression of transmembrane protease, serine 3 (TMPRSS3) has been detected in ovarian cancer. However, the molecular mechanisms of TMPRSS3 in ovarian cancer remain unclear. In the present study, we found that TMPRSS3 was significantly expressed in ovarian cancer cells. Overexpression

Protocols

Coronavirus qPCR Primer and probe sets for the detection of SARS-CoV-2 (Corona Virus), with additional real-time RT-PCR, RT-qPCR and supporting reagents available.

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service