Skip to Content
Merck
All Photos(1)

Key Documents

EHU024471

Sigma-Aldrich

MISSION® esiRNA

targeting human FADD

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGCTCGTCAGCTCAAAGTCTCAGACACCAAGATCGACAGCATCGAGGACAGATACCCCCGCAACCTGACAGAGCGTGTGCGGGAGTCACTGAGAATCTGGAAGAACACAGAGAAGGAGAACGCAACAGTGGCCCACCTGGTGGGGGCTCTCAGGTCCTGCCAGATGAACCTGGTGGCTGACCTGGTACAAGAGGTTCAGCAGGCCCGTGACCTCCAGAACAGGAGTGGGGCCATGTCCCCGATGTCATGGAACTCAGACGCATCTACCTCCGAAGCGTCCTGATGGGCCGCTGCTTTGCGCTGGTGGACCACAGGCATCTACACAGCCTGGACTTTGGTTCTCTCCAGGAAGGTAGCCCAGCACTGTGAAGACCCAGCAGGAAGCCAGGCTGAGTGAGCCACAGACCACCTGCTTCTGA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Christiana G Savva et al.
BMC cancer, 16, 279-279 (2016-04-22)
Acquired resistance towards apoptosis is a hallmark of cancer. Elimination of cells bearing activated oncogenes or stimulation of tumor suppressor mediators may provide a selection pressure to overcome resistance. KC-53 is a novel biyouyanagin analogue known to elicit strong anti-inflammatory
Shih-Wei Wang et al.
Molecular carcinogenesis, 57(7), 866-877 (2018-03-23)
Luteolin (3',4',5,7-tetrahydroxyflavone), which exists in fruits, vegetables, and medicinal herbs, is used in Chinese traditional medicine for treating various diseases, such as hypertension, inflammatory disorders, and cancer. However, the gene-regulatory role of luteolin in cancer prevention and therapy has not
Zongliang Lu et al.
International journal of oncology, 56(2), 439-447 (2020-01-03)
Ophiopogonin D' (OPD') is a natural compound extracted from Ophiopogon japonicus, which is a plant used in traditional Chinese medicine. Our previous study has indicated that OPD' exhibits antitumor activity against androgen‑independent prostate cancer (PCa), but the effects and the
Fangfang Cai et al.
Cell death & disease, 11(1), 33-33 (2020-01-18)
Hydrogen sulfide (H2S) is now widely considered the third endogenous gasotransmitter and plays critical roles in cancer biological processes. In this study, we demonstrate that 5-(4-hydroxyphenyl)-3H-1,2-dithiole-3-thione (ADT-OH), the most widely used moiety for synthesising slow-releasing H2S donors, induces melanoma cell
Liang-Jun Wang et al.
Biochemical pharmacology, 162, 154-168 (2018-11-11)
Albendazole (ABZ) is a microtubule-targeting anthelmintic that acts against a variety of human cancer cells, but the dependence of its cytotoxicity on non-mitotic effect remains elusive. Thus, we aimed to explore the mechanistic pathway underlying the cytotoxicity of ABZ in

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service