Skip to Content
Merck
All Photos(1)

Documents

EHU088101

Sigma-Aldrich

MISSION® esiRNA

targeting human VCL

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CGGGTTGGAAAAGAGACTGTTCAAACCACTGAGGATCAGATTTTGAAGAGAGATATGCCACCAGCATTTATTAAGGTTGAGAATGCTTGCACCAAGCTTGTCCAGGCAGCTCAGATGCTTCAGTCAGACCCTTACTCAGTGCCTGCTCGAGATTATCTAATTGATGGGTCAAGGGGCATCCTCTCTGGAACATCAGACCTGCTCCTTACCTTCGATGAGGCTGAGGTCCGTAAAATTATTAGAGTTTGCAAAGGAATTTTGGAATATCTTACAGTGGCAGAGGTGGTGGAGACTATGGAAGATTTGGTCACTTACACAAAGAATCTTGGGCCAGGAATGACTAAGATGGCCAAGATGATTGACGAGAGACAGCAGGAGCTCACTCACCAGGAGCACCGAGTGATGTTGGTGAACTCGATGAACACCGTGA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Stephen G Turney et al.
Molecular biology of the cell, 27(3), 500-517 (2015-12-04)
Nerve growth factor (NGF) promotes growth, differentiation, and survival of sensory neurons in the mammalian nervous system. Little is known about how NGF elicits faster axon outgrowth or how growth cones integrate and transform signal input to motor output. Using
Beenu Moza Jalali et al.
Theriogenology, 116, 17-27 (2018-05-16)
During early pregnancy, uterine epithelial cells undergo major transformations in their cytoskeleton that make the endometrium receptive for conceptus attachment. Actin binding proteins (ABPs) such as cofilin, gelsolin, and vinculin are involved in regulating actin polymerization, severing or crosslinking actin
Fangjia Li et al.
Scientific reports, 9(1), 5615-5615 (2019-04-06)
This study utilized a Förster resonance energy transfer (FRET)-based molecular tension sensor and live cell imaging to evaluate the effect of osteocytes, a mechanosensitive bone cell, on the migratory behavior of tumor cells. Two cell lines derived from MDA-MB-231 breast
Tanchen Ren et al.
Biomaterials, 56, 58-67 (2015-05-03)
Selective enhancement of directional migration of Schwann cells (SCs) over fibroblasts (FIBs) plays a significant role in peripheral nerve regeneration, because this behavior facilitates neuron repair and avoids fibrosis. Herein a complementary density gradient of poly(3-dimethyl-methacryloyloxyethyl ammonium propane sulfonate) (PDMAPS
Elisabetta Palazzo et al.
International journal of molecular sciences, 16(11), 26291-26302 (2015-11-06)
The Notch signaling pathway orchestrates cell fate by either inducing cell differentiation or maintaining cells in an undifferentiated state. This study aims to evaluate Notch expression and function in normal human keratinocytes. Notch1 is expressed in all epidermal layers, though

Articles

Quantitative and qualitative western blotting to validate knockdown by esiRNA. Sigma-Aldrich.com

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service