Direkt zum Inhalt
Merck
Alle Fotos(1)

Key Documents

EHU090231

Sigma-Aldrich

MISSION® esiRNA

targeting human REST

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

GAGCGAGTATCACTGGAGGAAACATTTAAGAAACCATTTTCCAAGGAAAGTATACACATGTGGAAAATGCAACTATTTTTCAGACAGAAAAAACAATTATGTTCAGCATGTTAGAACTCATACAGGAGAACGCCCATATAAATGTGAACTTTGTCCTTACTCAAGTTCTCAGAAGACTCATCTAACTAGACATATGCGTACTCATTCAGGTGAGAAGCCATTTAAATGTGATCAGTGCAGTTATGTGGCCTCTAATCAACATGAAGTAACCCGCCATGCAAGACAGGTTCACAATGGGCCTAAACCTCTTAATTGCCCACACTGTGATTACAAAACAGCAGATAGAAGCAACTTCAAAAAACATGTAGAGCTACATGTGAACCCACGGCAGTTCAATTGCCCTGTATGTGACTATGCAGCTTCCAAG

Ensembl | Human Hinterlegungsnummer

ENSG00000084093

NCBI-Hinterlegungsnummer

NM_005612

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

human ... REST(5978) , REST(5978)

Verwandte Kategorien

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Wai Hon Chooi et al.
Biomaterials science, 6(11), 3019-3029 (2018-10-03)
The use of human induced pluripotent stem cell-derived neural progenitor cells (hiPSC-NPCs) is an attractive therapeutic option for damaged nerve tissues. To direct neuronal differentiation of stem cells, we have previously developed an electrospun polycaprolactone nanofiber scaffold that was functionalized
James C Geoghegan et al.
Molecular therapy. Nucleic acids, 1, e53-e53 (2012-01-01)
Delivery of small interfering RNA (siRNA) targeted to specific cell types is a significant challenge for the development of RNA interference-based therapeutics. Recently, PTD-DRBD, a double-stranded RNA binding domain (DRBD) fused to the TAT protein transduction domain (PTD), was shown
Rui Wang et al.
International journal of molecular medicine, 42(5), 2831-2838 (2018-08-23)
Type 1 diabetes involves the immunologically mediated destruction of insulin‑producing cells (IPCs) in the pancreatic islet. Mesenchymal stem cells (MSCs) have the ability to differentiate into IPCs and have become the most promising means for diabetes therapy. The present study
Gopal Pandi et al.
PloS one, 8(3), e58039-e58039 (2013-03-22)
Recent studies showed that stroke extensively alters cerebral microRNA (miRNA) expression profiles and several miRNAs play a role in mediating ischemic pathophysiology. We currently evaluated the significance of miR-29c, a highly expressed miRNA in rodent brain that was significantly down-regulated
Wei Wang et al.
Molecular biology of the cell, 22(6), 868-879 (2011-01-29)
Developing neurons undergo a series of maturational stages, and the timing of these events is critical for formation of synaptic circuitry. Here we addressed temporal regulation of the Gabra6 gene, which is expressed in a delayed manner during dendritogenesis in
Alle zugehörigen Dokumente anzeigen

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.